We narrowed to 5,071 results for: Mos
-
Plasmid#176981PurposeMammalian expression vector encoding KCNJ15 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only
-
CRYZL1_pcDNA6.2/EmGFP-Bsd
Plasmid#176941PurposeMammalian expression vector encoding CRYZL1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-178
Plasmid#108284PurposeExpresses residues 4-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-279DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationdeleted amino acids 1-3 and 179-199Available SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1B 4-199
Plasmid#115325PurposeExpresses residues 4-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-23DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ir7f-T2A-QF2 HDR plasmid
Plasmid#140942PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti Ir7f geneDepositorInsertIr7f-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir7f-right-HDR-arm
Mutation4 point mutations (annotated on plasmid map) were…Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154A/H250Y
Plasmid#108489Purposeexpression of vsv-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsVSVExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only