We narrowed to 16,181 results for: nes
-
Plasmid#214481PurposeAiE2016m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
AiP1657 - pAAV-AiE2339m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214508PurposeAiE2339m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1969 - pAAV-AiE2563m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214597PurposeAiE2563m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304 SLC2A1
Plasmid#193691PurposeConstitutive lentiviral expression of SLC2A1DepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGW011b Dual AAV vector pAAV-EFS-dCAS9-spA
Plasmid#192160PurposeDual AAV vector AAV-dCas9DepositorInsertDead Cas9
UseAAVMutationNAAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
1137=Hsp70Bb-Cas9[dsRed]
Plasmid#149424PurposeThe piggyBac plasmid harboring Hsp70Bb-Cas9-T2A-eGFP-p10 and Opie2-dsRed-SV10 (marker gene)DepositorInsertCas9
UseCRISPRTagseGFPExpressionInsectPromoterDmel Hsp70BbAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
IDG_TMEM38B_OE_1
Plasmid#161658PurposeOverexpresses TMEM38BDepositorAvailable sinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pInducer10-UBC9-sh4
Plasmid#168988PurposeExpresses RFP cDNA and UBC9 shRNA 4 in mammalian cellsDepositorInsertUbiquitin Conjugating Enzyme 9
ExpressionMammalianPromoterUbc promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtTcR1AtR2NtB2
Plasmid#160889PurposeExpression of N. tabacum Rubisco small subunit (rbcS-Tc), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-Tc
ExpressionBacterialPromoterrbcS-Tc: T7, chaperones: T12Available sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-METTL14-WT
Plasmid#141118PurposeRetroviral overexpression of WT METTL14 in mammalian cells.DepositorAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-RABIF
Plasmid#130882PurposeExpresses human RABIF with N-terminal GFP tagDepositorAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-RAB10 K154A
Plasmid#130886PurposeExpresses human RAB10 K154A mutant with N-terminal GFP tagDepositorAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
negAKARet-cyto
Plasmid#114733PurposeNegative control of AKARet-cytoDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNegative Control of AKARet-cyto
TagsEGFP and sREAChetExpressionMammalianPromoterCMVAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LI F-G Spec
Plasmid#104521PurposeLI resistance gene moduleDepositorInsertSpectinomycin resistance gene
UseCloning vectorAvailable sinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR8 LCOR
Plasmid#114441PurposeEntry vector for gateway cloning containing human LCOR coding sequenceDepositorAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSetd2#1/Cre
Plasmid#89649PurposeExpresses a Setd2-targeting gRNA and Cre-recombinaseDepositorAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only