We narrowed to 59,739 results for: Gene
-
Plasmid#65392PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertSP110A
TagsEmGFP and V5ExpressionMammalianMutationnonePromoterCMVAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEG302-LHP1-ZF
Plasmid#200911PurposeExpress LHP1-ZF108 in Arabidopsis target FWA geneDepositorInsertLHP1
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-MSI1-ZF
Plasmid#200912PurposeExpress MSI1-ZF108 in Arabidopsis target FWA geneDepositorInsertMSI1 (MSI1 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ14-ZF
Plasmid#200913PurposeExpress JMJ14-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ14
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2A-ZF
Plasmid#200915PurposeExpress HD2A-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2A
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ18-ZF
Plasmid#200919PurposeExpress JMJ18-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ18 (JMJ18 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-ELF7-ZF
Plasmid#200920PurposeExpress ELF7-ZF108 in Arabidopsis target FWA geneDepositorInsertELF7 (ELF7 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-DMS3-ZF
Plasmid#200921PurposeExpress DMS3-ZF108 in Arabidopsis target FWA geneDepositorInsertDMS3 (DMS3 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH2-ZF
Plasmid#200922PurposeExpress SUVH2-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH2 (SUVH2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH9-ZF
Plasmid#200923PurposeExpress SUVH9-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH9 (SUVH9 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-MORC1-ZF
Plasmid#200924PurposeExpress MORC1-ZF108 in Arabidopsis target FWA geneDepositorInsertMORC1
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCVD531
Plasmid#66160PurposeA 8.9 kb HindIII fragment carrying the tdh-like gene of Vibrio hollisae strain 9041 was cloned into the HindIII site of pBR322.DepositorInserttdh-like
UseCloning vectorPromoterUnknownAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-NanoLuc-Puromycin
Plasmid#167209PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with NanoLuc and selection with PuromycinDepositorTypeEmpty backboneUseCRISPRTagsNanoLucExpressionMammalianAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pdpy-30-miniCAFE
Plasmid#170115PurposeDpy-30 promoter-driven expression of a truncated VPR-dCjCas9 fusion protein (MiniCAFE) for activation of gene expression.DepositorInsertMiniCAFE
UseCRISPRMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterDpy-30Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
iMb-Control-Mosaic (IR98.10)
Plasmid#99748PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different fluorescent and marker proteins localized to the membraneDepositorInsertMbYFP, MbTomato, MbKate2
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS2116
Plasmid#49141PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA-dCas9-p300 Core (1645/1646 RR/EE)
Plasmid#61359Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation 1645/1646 RR/EE) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, Synthetic, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1645/1646 RR/EE m…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHK101
Plasmid#235480PurposeRepression of gene VIII by Ptet promoterDepositorInsertphage M13 geneVIII, cI repressor
ExpressionBacterialAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEL1019
Plasmid#225271PurposeCas12i2Max variant backbone for gene editing in riceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK326
Plasmid#235475PurposeInducible gene VIII by Ptac promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK346
Plasmid#235477PurposeInducible gene VIII by Pbad promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK336
Plasmid#235476PurposeInducible gene VIII by Plux promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
lvl0-G-CasE
Plasmid#229184Purposelvl 0 5 geneDepositorInsertCasE
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
lvl0-G-Gal4-VPR
Plasmid#229187Purposelvl 0 5 geneDepositorInsertGal4-VPR
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-Tn7-PrpsM
Plasmid#225282PurposeMini-Tn7 pGP-Tn7-Cm vector with constitutive PrpsM promoter for the constitutive expression of target genes inserted into the attTn7 chromosomal site.DepositorTypeEmpty backboneExpressionBacterialPromoterConstitutive PrpsM promoterAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only