We narrowed to 16,375 results for: grna
-
-
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSI-535
Plasmid#131130PurposegRNA expression vector for C-to-T base editing reporterDepositorInsertC-to-T reporter activation gRNA
UseCRISPRExpressionMammalianPromoterHuman U6 promoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROF441
Plasmid#155336PurposeBinary vector for expression of a gRNA targeting AtAP1 promoterDepositorInsertLB_PAtU6-26-gRNA(PAtAP1)-sgRNA_RB
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgGFP4
Plasmid#119876PurposegRNA expression vectorDepositorInsertsgGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
BRD4 CRISPRi plasmid
Plasmid#154890PurposeHuman BRD4 CRISPRi gRNADepositorInsertBRD4-targeting gRNA
UseCRISPR and LentiviralAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgGFP3
Plasmid#119875PurposegRNA expression vectorDepositorInsertsgGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo U6-SpAi9L-U6SpDMDL
Plasmid#78608PurposeExpresses gRNAs (for SpCas9) targeting 5’ of Ai9 stop cassette and Dmd intron 22DepositorInsertU6-SpAi9L-U6SpDMDL
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo U6-SpAi9R-U6-SpDMDR
Plasmid#78609PurposeExpresses gRNAs (for SpCas9) targeting 3’ of Ai9 stop cassette and Dmd intron 23DepositorInsertU6-SpAi9R-U6-SpDMDR
UseUnspecifiedPromoterU6Available SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-CsALSgR1.1
Plasmid#245875PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALS_gRNA1.1
UseCRISPR; Golden gate entry vector to expressing t…ExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only