We narrowed to 42,956 results for: gats
-
Plasmid#242600PurposeA PiggyBac expression vector containing the core promoter from human EF1a driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110)
ExpressionMammalianPromoterhuman EF1aAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-ActinVhh-sfGFP-P2A-HA-tdiRFP-caax (JDW 1532)
Plasmid#242606PurposeA CAGGS driven expression vector containing an actin nanobody fused to sfGFP to label actin followed by a HA tagged tdiRFP fused to a caax tag to label the cell membrane.DepositorInsertActin Vhh-sfGFP-P2A-HA-tdiRFP-caax
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Neo-2/15-TGFa-SPMn-SpyTag003
Plasmid#246650PurposeExpresses Neo-2/15-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInsertNeo-2/15-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Neo2/…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)
Plasmid#215451PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF)DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR2b-ITGB1(WT)-mRuby2
Plasmid#215446PurposeGateway entry vector with integrin beta1 tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF3379
Plasmid#144855PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3107
Plasmid#144583PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-8D2Q.Tau2N4R-WPRE
Plasmid#226382PurposeExpresses tau propagation ORF with V5 tag on 8D2Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation8D2Q.Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-20D3Q.Tau2N4R-WPRE
Plasmid#226383PurposeExpresses tau propagation ORF with V5 tag on 20D3Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation20D3Q, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-8A2R.Tau2N4R-WPRE
Plasmid#226384PurposeExpresses tau propagation ORF with V5 tag on 8A2R mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation8A2R, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-20A3R.Tau2N4R-WPRE
Plasmid#226385PurposeExpresses tau propagation ORF with V5 tag on 20A3R mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation20A3R, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-K281Q.Tau2N4R-WPRE
Plasmid#226386PurposeExpresses tau propagation ORF with V5 tag on K281Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutationK281Q, 2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-K353Q.Tau2N4R-WPRE
Plasmid#226387PurposeExpresses tau propagation ORF with V5 tag on K353Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutationK353Q, 2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S198D.Tau2N4R-WPRE
Plasmid#226388PurposeExpresses tau propagation ORF with V5 tag on S189D mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutationS198D.Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S199D.Tau2N4R-WPRE
Plasmid#226389PurposeExpresses tau propagation ORF with V5 tag on S199D mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T-2A-V5ExpressionMammalianMutationS199D, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S202D.Tau2N4R-WPRE
Plasmid#226390PurposeExpresses tau propagation ORF with V5 tag on S202D mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutationS202D, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-S404D.Tau2N4R-WPRE
Plasmid#226391PurposeExpresses tau propagation ORF with V5 tag on S404D mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutationS404D, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-T217D.Tau2N4R-WPRE
Plasmid#226392PurposeExpresses tau propagation ORF with V5 tag on T217D mutant 2N4R tauDepositorInsertTau2N4R (MAPT Human, synthetic)
TagsTagRFP.T.2A.V5ExpressionMammalianMutationT217D, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only