169,691 results
-
Plasmid#120361PurposeProduce human recombinant TGFB1 in DE3 cellsDepositorInsertTransforming Growth Factor-β1 (TGFB1 Synthetic, Human)
Tags6x His and S-TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 hygro
Plasmid#24150Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses hygromycin for selection.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterU6 for shRNAAvailable SinceMarch 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-MBP
Plasmid#72323PurposeBacterial expression of Maltose Binding Protein linked to SnoopTag, a peptide tag forming a spontaneous covalent bond with its protein partner Snoopcatcher.DepositorInsertpET28a SnoopTag-MBP
TagsN-terminal His6 tag. MBP is fused at the C-termin…ExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC hRap1-FL
Plasmid#12542DepositorInsertRepressor Activator Protein 1 (TERF2IP Human)
UseRetroviralAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
gag-P3-pol
Plasmid#211374PurposePackaging plasmid for v3b PE-eVLP productionDepositorInsertMMLVgag-P3-pol
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga15
Plasmid#196060PurposeEncodes a G alpha subunit (GNA15) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-CYLD-STOP
Plasmid#60077PurposeN-terminal GFP tagged CYLD with stop codon, driven by CMV promoterDepositorAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CA
Plasmid#20960PurposepiggyBac empty vector with Gatweway cassette and CAG constitutive promoterDepositorInsertGateway Destination Vector
UsepiggybacExpressionMammalianAvailable SinceMay 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-mtagBFP-2A RIGI WT
Plasmid#167289PurposeLentiviral expression construct encoding a TagBFP in frame with a self-cleaving wild-type RLR sensor RIG-IDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only