We narrowed to 23,118 results for: Sis
-
Plasmid#215189PurposeEvaluating guard cell specific promotors in BarleyDepositorInsertInwardly rectifying K+ channel1
UseSynthetic BiologyExpressionPlantPromoterStKST1Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bo_NPTII:pKST:Gus_introns
Plasmid#215175PurposeEvaluating guard cell specific promotors in BrassicaDepositorInsertInwardly rectifying K+ channel1
UseSynthetic BiologyPromoterpKST1Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bo_NPTII:pCSRM2C:Gus_introns
Plasmid#215177PurposeEvaluating guard cell specific promotors in BrassicaDepositorInsertScream2
UseSynthetic BiologyPromoterpSCRM2Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO411
Plasmid#235732PurposeProtein expression of ZZ-FL yeast Atg14 in yeastDepositorInsertATG14
Tags3xTEV-ZZExpressionYeastAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO831
Plasmid#235754PurposeProtein expression of ZZ-ScVPS38 (1-212F)DepositorInsertVPS38
TagsZZ-3xTEVExpressionYeastMutationaa 1-212FAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO225
Plasmid#235729PurposeProtin expression of FL yeast VPS15 -ZZ in yeastDepositorInsertVPS15
Tags3xTEV-ZZExpressionYeastAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO290
Plasmid#235731PurposeProtein expression in FL yeast VPS34 D731N mutant in yeastDepositorInsertVPS34
ExpressionYeastMutationS2A, D731NAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO69
Plasmid#235747PurposeProtein expression of FL ScVPS34 in yeastDepositorInsertVPS34
ExpressionYeastMutationS2AAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO361
Plasmid#235748PurposeProtein expression of ScVPS34 HELCATDepositorInsertVPS34 HELCAT
ExpressionYeastMutationaa 268-875Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO227
Plasmid#235749PurposeProtein expression of ZZ-FL ScVPS30DepositorInsertVPS30
TagsZZ-3xTEVExpressionYeastAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO832
Plasmid#235755PurposeProtein expression of ScVPS30 (1-215E), untaggedDepositorInsertScVPS30
ExpressionYeastMutationaa 1-215EAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO478
Plasmid#235757PurposeExpression of FL ScVPS34-3xFLAG under its own promoterDepositorInsertVPS34
Tags3xFLAGExpressionYeastPromoterScVPS34 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO764
Plasmid#235761PurposeExpression of ScVPS38-EGFP under its own promoterDepositorInsertVPS38
TagsEGFPExpressionYeastPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-C-term K-R
Plasmid#233092PurposeExpression of GST-YihI with C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationC-term lysines (K) mutated to arginine (R)Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-S1BD
Plasmid#232580PurposeExpression of the Rnr S1 and basic domains (residues 1930 to 2442) as a GST-fusion.DepositorInsertRnr S1 + basic domain (residues 1930 to 2442)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-ND
Plasmid#232579PurposeExpression of the Rnr nuclease domain (residues 649 to 1929) as a GST-fusion.DepositorInsertRnr nuclease domain (residues 649 to 1929)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-CSD
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only