We narrowed to 19,582 results for: Cre
-
Plasmid#139649PurposeReporter assayDepositorInsertH2B-mCherry
UseLentiviralTagsFLAG, His6Available SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg1 hp
Plasmid#218093PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_703128
Plasmid#224394PurposeFor expression of the type I CBASS system encoded by Escherichia coli 703128DepositorInsertEcCdnD_4TM
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_BWH59
Plasmid#224393PurposeFor expression of the type I CBASS system encoded by Escherichia coli BWH59DepositorInsert2TM_EcCdnD
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
IA001: pMVP (L3-L2) 3x HA epitope tag+ polyA
Plasmid#121750PurposepMVP L3-L2 entry plasmid, contains 3x HA epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsert3x HA epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-CT3G-ERP2-MG-IRES2-mNeonGreen
Plasmid#175506PurposeAll-in-one piggyBac transposon destination vector for mCMV+dox-inducible expression of Mega Gate cloned elements upstream of IRES2-mNeonGreen (hEF1a-driven rtTA and puromycin resistance)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterTRE3G-mCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME18ST-d5-HT7
Plasmid#53111PurposeExpression of Drosophila 5-HT7DepositorInsert5HT7 (5-HT7 Fly)
Available SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
p3E-RhoAb-DN
Plasmid#109580PurposeMultisite gateway vector for 3' tagging with dominant negative RhoAbDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-APEX2-P2A-mKate2
Plasmid#67671PurposeMultisite gateway entry clone for adding C-terminal fusions of APEX2-P2A-mKate2DepositorInsertAPEX2-P2A-mKate2
UseGateway multisite 3' entry cloneAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOCC292
Plasmid#118881Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with C-terminal mRuby3, and C-terminal HIS6 tag, cleavable with 3CDepositorInsertNcoI-NotI-ccdB-AscI-mRuby3-3C-HIS6-stop-HindIII cassette
TagsmRuby3, HIS6, cleavable with 3C proteaseExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBMN ER50-YFP
Plasmid#37259DepositorInsertER50 (ESR1 Human)
UseRetroviralTagsYFP-HAMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…PromoterLTRAvailable SinceAug. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGWB523
Plasmid#74865PurposeGateway cloning compatible binary vector for C-terminal fusion with GST (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pssAAV_Seq17_CMV_bglobin_3NLS_Venus_WPRE_polyA
Plasmid#220224PurposeAAV-STARR-seq validation control vector with VenusDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB507
Plasmid#74849PurposeGateway cloning compatible binary vector for C-terminal fusion with 6xHis (no promoter).DepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntn4-AP-His
Plasmid#71980PurposeExpresses the entire Netrin 4 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Consensus
Plasmid#176664PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pb459-mU6-sgRNA-EF1a-PuroR
Plasmid#195507Purposepiggybac vector expressing non-targeting control sgRNA cloned using BlpI and BstXI sitesDepositorInsertPuromycin
UseCRISPR; PiggybacExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-M2-PAK2 wt
Plasmid#31680DepositorAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
polyPRM5
Plasmid#175232PurposeBacterial expression and purification, mixed with polySH3 to form condensatesDepositorAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only