We narrowed to 14,065 results for: crispr grnas
-
Plasmid#104789PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from rolD promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC13
Plasmid#104787PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor_sU6
Plasmid#69351PurposesgRNA scaffold and synthetic U6 promoterDepositorInsertsU6 promoter and sgRNA scaffold flanked by BbsI sites
UseCRISPRPromotersynthetic U6 promoterAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pV1090
Plasmid#111427PurposegRNA entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at RPS1 (Part of Duet system)DepositorInsertsgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g3
Plasmid#153013PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC-H1-Esp3I-mU6-Kan
Plasmid#213015PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (H1 and mU6)DepositorInsertH1 promoter, mU6 promoter, gRNA scaffolds
PromoterH1 promoterAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-sgTAF12(human)#4.5
Plasmid#105987Purposelentivirally express gRNA targeting human TAF12 HFD with GFP markerDepositorInsertgRNA targeting human TAF12-HFD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_NC_chr1
Plasmid#214688PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_TP73
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330A-1x2
Plasmid#58766PurposeExpresses Cas9 nuclease and gRNADepositorInserthumanized S. pyogenes Cas9 nuclease
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
AP568-3
Plasmid#70048Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP568-2
Plasmid#70047Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
AIO-mCherry
Plasmid#74120PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and mCherry-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
AIO-GFP
Plasmid#74119PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and EGFP-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U6SC
Plasmid#134755PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-35SCAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3K-U6SC
Plasmid#134754PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-35SCAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3B-U6SC
Plasmid#134753PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-35SCAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3B-U3Ub
Plasmid#134750PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only