We narrowed to 70 results for: plko 1 lentiviral shrna vector

#69041

3rd generation lentiviral vector expressing IKZF1 shRNA

William Kaelin

Lu et al Science. 2014 Jan 17;343(6168):305-9. do

Oct. 10, 2017

Academic Institutions and Nonprofits only

#110414

TRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selection

Sandra Martha Gomes Dias

Feb. 23, 2021

Academic Institutions and Nonprofits only

#1864

3rd gen lentiviral negative control vector containing scrambled shRNA

David Sabatini

Sarbassov et al Science 2005 Feb 18;307(5712):1098-101.

April 5, 2006

Academic Institutions and Nonprofits only

#133459

U6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrR

John Doench

DeWeirdt et al Nat Commun. 2020 Feb 6;11(1):752. doi: 1

Oct. 29, 2019

Academic Institutions and Nonprofits only

#64114

Vector for expression of Sp sgRNA2 in mammalian cells

Thoru Pederson

Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;11

April 24, 2015

Academic Institutions and Nonprofits only

#64115

Vector for expression of Nm sgRNA1.1 in mammalian cells

Thoru Pederson

Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;11

April 24, 2015

Academic Institutions and Nonprofits only

#64118

Vector for expression of St1 sgRNA3.1 in mammalian cells

Thoru Pederson

Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;11

April 24, 2015

Academic Institutions and Nonprofits only

#64117

Vector for expression of St1 sgRNA2.1 in mammalian cells

Thoru Pederson

Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;11

April 24, 2015

Academic Institutions and Nonprofits only

#64116

Vector for expression of St1 sgRNA1.1 in mammalian cells

Thoru Pederson

Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;11

April 24, 2015

Academic Institutions and Nonprofits only

#133043

Doxycycline-inducible SiC-V2 vector with Cas9G7 (sgRNA 7 targeting SpCas9 gene). In cells coexpressing Cas9 nuclease, this construct causes self-inactivation/editing of SpCas9 gene upon Dox addition.

Sriram Neelamegham

Kelkar et al Mol Ther. 2019 Sep 12. pii: S1525-0016(1

Nov. 26, 2019

Academic Institutions and Nonprofits only