We narrowed to 78 results for: pshuttle
-
Plasmid#112538PurposeAdenovirus overexpressionDepositorInsertmiR-23b (MIR23B Human)
UseAdenoviralAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ad-CBR (GFP/cAPC)
Plasmid#16576DepositorAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
Ad-HisFlag-USP19CYT
Plasmid#155245Purposefor generating adenoviruses expressing the cytoplasmic isoform of rat USP19DepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
huCof WT-mRFP
Plasmid#245973PurposeNeuronal specific expression of cof-mRFPDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof K95Q-mRFP
Plasmid#245974PurposeExpression of cofilin with mutation in one actin binding domainDepositorAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad-HisFlag-USP19ER
Plasmid#155244Purposefor generating adenoviruses expressing the ER isoform of rat USP19DepositorInsertUSP19 (ER isoform) (Usp19 Rat)
UseAdenoviralTags6XHis-3XFlagMutationH118R- please see dep. commentsPromoterCMVAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
huCof C139S-mRFP
Plasmid#245969PurposeExpression of cof with one of 4 cys mutated to ser. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof C147A-mRFP
Plasmid#245970PurposeExpression of cof with one of 4 cys mutated to ala .Incorporates into cofilactin rodsDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof C147S-mRFP
Plasmid#245971PurposeExpression of cof with one of 4 cys mutated to ser. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof C39A,C147A-mRFP
Plasmid#245972PurposeExpression of cof with two of 4 cys mutated to A. Does NOT incorporate into cofilin-actin rods .DepositorInsertcofilin 1 (cfl1) (CFL1 Human)
TagsmRFPExpressionMammalianMutationC39A,C147APromoterCMVAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof C39A-mRFP
Plasmid#245966PurposeExpression of cof with one of 4 cys mutated to ala. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof C39S-mRFP
Plasmid#245967PurposeExpression of cof with one of 4 cys mutated to ser. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof C139A-mRFP
Plasmid#245968PurposeExpression of cof with one of 4 cys mutated to ala. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
SSH-3 WT
Plasmid#245957PurposeExpression of wild-type slingshot 3, a cofilin pSer3 phosphataseDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-huCof R21Q-mRFP
Plasmid#245964PurposeExpression of the weak F-actin binding R21Q cofilin-mRFP which serves as a cofilactin rod reporter without inducing rodsDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof K22Q-mRFP
Plasmid#245965PurposeExpression of the weak F-actin binding K22Q cofilin-mRFP which serves as a cofilactin rod reporter without inducing rodsDepositorAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only