We narrowed to 1,600 results for: αGFP
-
Plasmid#139638PurposeGFP-tagged gene expressionDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PTPRA_C723S-GFP fusion
Plasmid#139639PurposeGFP-tagged gene expressionDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaZ
Plasmid#196053PurposeEncodes a G alpha subunit (GNAZ) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria3-GFP KI
Plasmid#131491PurposeEndogenous tagging of GluA3: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHeEf1a-mEGFP-NLS
Plasmid#205012PurposeThe vector contains 1kbp of the upstream and downstream regions of the ef1a gene from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the ef1a gene from Hypsibius exemplaris
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1α-Lox2272-LoxP-MARKS·mTurquoise2-NLS·turboRFP-Lox2272-LoxP
Plasmid#198753PurposeCre reporter, which switches from membraneous mTurquoise to nuclear RFP upon Cre recombinase activityDepositorInsertEF1a promotor-Lox2272-LoxP-MARKS-mTurquoise2-NLS.turboRFP-Lox2272-LOXP
UseLentiviralExpressionBacterial and MammalianMutationSee depositor comments belowPromoterEF1aAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)5
Plasmid#127506PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 5 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 5 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)7
Plasmid#127507PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 7 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 7 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)4
Plasmid#127505PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 4 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-Pard3-EGFP-PIF6
Plasmid#154914PurposeFull length zebrafish Pard3 (Gene ID: 403050), tagged with EGFP fluorescent protein and Arabidopsis PIF6 (as in construct Addgene ID 154913).DepositorInsertpar-3 family cell polarity regulator alpha, b (pard3ab Zebrafish)
UseXenopus/avian/zebrafishTags1-100 amino acids of Arabidopsis PIF6 and EGFPExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6/TO-shEsr1-CMV-TetR-eGFP
Plasmid#233298PurposeDOX-inducible U6 driven shRNA against mouse Esr1DepositorAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa2-Cas9-GFP
Plasmid#208050PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa2DepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV CMV mCherry-DDX21-V5
Plasmid#175163PurposeLentiviral expression of human DDX21-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DNii domain
Plasmid#234557PurposeCTNNA1 Nii-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DNii domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa ~165-265PromoterCMVAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-domain
Plasmid#234555PurposeCTNNA1 M1-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM1-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 271-396PromoterCMVAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_deltaD2-GFP fusion
Plasmid#139641PurposeGFP-tagged gene expressionDepositorInsertPTPRA_deltaD2 (PTPRA Human)
TagsGFPExpressionMammalianMutationD2 domain deletionPromoterCMVAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_deltaD1-GFP fusion
Plasmid#139640PurposeGFP-tagged gene expressionDepositorInsertPTPRA_deltaD1 (PTPRA Human)
TagsGFPExpressionMammalianMutationD1 domain deletionPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pN-PITCh-FAID
Plasmid#127885PurposeProvides the repair template with PP2Ac microhomology on each end for PP2Ac N-ter FAID taggingDepositorAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only