We narrowed to 3,367 results for: aaas
-
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE3 mutant
Plasmid#133310PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 3DepositorInserteIF3B promoter MBE3 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationccacgtgacc changed to cAaAAAAaccPromotereIF3BAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode8
Plasmid#229070PurposeExpression mappingDepositorInsertCAG Barcode8
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode19
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
LHZ1494
Plasmid#222104PurposeTriple sgRNAs expression plasmid in Kluyveromyces marxianus.DepositorInsertsg1RNA, sg4RNA, sg7RNA
UseCRISPRExpressionYeastAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS15_MATz
Plasmid#166100PurposeExpression of dual gRNA targeting the MAT locusDepositorInsertMAT Z1
UseCRISPRExpressionYeastAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfb13221
Plasmid#219896PurposeThe base plasmid of TUNEYALI for TF31DepositorInsertContains gRNA targeting TF31 (YALI1_D18727g) and homologous arm matching TF31
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEX-A-U6-MaSgRNA_PuroR
Plasmid#84780PurposeExpresses major satellite-specific sgRNA.DepositorInsertmajor satellite-specific sgRNA
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hBRAF-2
Plasmid#185366PurposeFor mammalian expression of guide RNA: caccgAAAATCCCACAGATGTGGCA that targets human BRAFDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU1-CDS
Plasmid#136048PurposeSTAU1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGAGTAAAGCCTAGAATCAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only