We narrowed to 13,275 results for: sequence
-
Plasmid#38229DepositorInsertHIS3 (HIS3 Budding Yeast, Synthetic)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3 (=GPD)Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH375-SUP45-P174Q
Plasmid#29383DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationP174Q mutant gene including genomic sequence 1432…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBTK205
Plasmid#110587PurposeBTK Type 3 coding sequence for golden gate assemblyDepositorInsertGFP optim-1
UseSynthetic BiologyAvailable SinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
peT3a-AqAdk_MVGDH
Plasmid#18092DepositorInsertadenylate kinase (kad A. aeolicus)
Tags6xHisExpressionBacterialMutationTyr 52 changed to Cys, Val 145 changed to Cys, …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
MTK4_004
Plasmid#123813PurposeEncodes spacer sequence as a Type 4 part to be used in the MTK systemDepositorInsertSpacer
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)MBII-85-3'ss mut
Plasmid#67644PurposeMBII85 snoRNA expression cassett, contains snoRNA in natural intron sorounded by natural exons. To improve snoRNA expression efficiency 3' splice site was mutated to consensus sequences.DepositorInsertMBII85 snoRNA
ExpressionMammalianMutation3' splice site muattionAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD8
Plasmid#112820PurposepSMF2 with 8 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD10
Plasmid#112821PurposepSMF2 with 10 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCK025
Plasmid#105415PurposeSynthetic biologyDepositorInsertHormone-binding domain and regulatory sequences (estrogen receptor)
UseSynthetic BiologyMutationBsaI/ BpiI restriction sites removedAvailable SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
PFA0445w-bio-His
Plasmid#50811PurposeExpresses enzymatically monobiotinylated full length PFA0445wDepositorInsertPFA0445w
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
PF10_0166-bio-His
Plasmid#50801PurposeExpresses enzymatically monobiotinylated full length PF10_0166DepositorInsertPF10_0166
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cwc25-pRSETA
Plasmid#61043PurposeEncodes the yeast Cwc25 protein for overexpression and purification using a C-terminal hexahistidine tag. A single cysteine residue is encoded after the Cwc25 sequence for fluorescent labeling.DepositorInsertCwc25
TagsTEV site, Histidine TagExpressionBacterialPromoterT7Available SinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWPT-UCU/ACC-mEGFP-IRES-mCherry
Plasmid#49232PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 - human TUBB6 Cterminal tail
Plasmid#60403PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta5 tubulin Cterminal tail (TUBB6) using a GAL promoterDepositorInsertTUB2
ExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable SinceMay 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCru5-GGG/ACC-mEGFP-IRES-mCherry
Plasmid#49221PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCru5-UCU/ACC-mEGFP-IRES-mCherry
Plasmid#49223PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCru5-ACC/ACC/ACC-mEGFP-IRES-mCherry
Plasmid#49219PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTarget-entry
Plasmid#220996PurposeProkaryotic expression of mRFP and GFP. Target sequences are inserted in place of the RFP gene through AatII/KpnI restriction ligationDepositorInsertmRFP, GFP
ExpressionBacterialAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only