We narrowed to 11,210 results for: nar
-
Plasmid#118412PurposeExpresses firefly luciferase under the control of a strong ubiquitous promoter EF1a along with a WPRE cassette. Backbone is compatible with both baculoviral and human production methods of AAV.DepositorInsertFirefly luciferase
UseAAV, Luciferase, and Synthetic BiologyExpressionInsect and MammalianPromoterEF1aAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-uvsY
Plasmid#163914PurposeExpresses uvsY for bacterial expression and affinity purificationDepositorAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-ABCC8-9-10
Plasmid#135918PurposeEncodes ABCC8 exons 9 and 10 wild type for the analysis of splicing variantsDepositorInsertATP-binding Cassette subfamily C member 8 (ABCC8 Human)
UseExon trappingExpressionMammalianPromoterSV40Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE
Plasmid#162377PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertjGCaMP8s
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationS26M F286Y Q315HPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-Bsu
Plasmid#163911PurposeExpresses Bsu large fragment for affinity purificationDepositorInsertBsu polymerase
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TRAF3_WT
Plasmid#81755PurposeGateway Donor vector containing TRAF3 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8f-WPRE
Plasmid#162379PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8f
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationQ315LPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE
Plasmid#162381PurposeAAV-mediated expression of ultrafast protein calcium sensor under the CAG promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8m
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationA25G F286YPromoterCAGAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-DmrB-DmrB-Ripk3-2A-mCherry-puro
Plasmid#231972PurposeTet inducible expression of DmrB-Ripk3 with mCherry to induce Ripk3 necroptosisDepositorInsertRipk3-deltaC dimerizing construct with bi-cistronic mCherry (Ripk3 Mouse)
UseLentiviralMutationWTAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TBK1_WT
Plasmid#82285PurposeGateway Donor vector containing TBK1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-DmrB-Casp8-2A-mCherry-puro
Plasmid#231971PurposeTet inducible expression of DmrB-Casp8 with mCherry to induce Casp8 apoptosisDepositorInsertCasp8 dimerizing construct with bi-cistronic mCherry (CASP8 Human)
UseLentiviralAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8m-WPRE
Plasmid#162378PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8m
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationA25G F286YPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TMPO_WT
Plasmid#81818PurposeGateway Donor vector containing TMPO , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SUV39H1_WT
Plasmid#82236PurposeGateway Donor vector containing SUV39H1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE
Plasmid#162380PurposeAAV-mediated expression of ultrafast protein calcium sensor under the CAG promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertjGCaMP8s
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationS26M F286Y Q315HPromoterCAGAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only