We narrowed to 8,284 results for: crispr grnas
-
Plasmid#177246PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpa gRNADepositorInsertsgCebpa_2nd
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpb_v1 (opti)
Plasmid#177247PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpb gRNADepositorInsertsgCebpb_1st
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpb_v2 (opti)
Plasmid#177248PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpb gRNADepositorInsertsgCebpb_2nd
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpd_v1 (opti)
Plasmid#177249PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpd gRNADepositorInsertsgCebpd_1st
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-MMETn-del-gRNA2
Plasmid#185007Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertMMETn-del-gRNA2
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-IAP-del-gRNA1
Plasmid#185002Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertIAP-del-gRNA1 (Akp3 Mouse)
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-MMERVK9C-del-gRNA1
Plasmid#185004Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertMMERVK9C-del-gRNA1
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-MMETn-del-gRNA1
Plasmid#185006Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertMMETn-del-gRNA1
UseCRISPRAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-MMERVK9C-del-gRNA2
Plasmid#185005Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertMMERVK9C-del-gRNA2
UseCRISPRAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-IAP-del-gRNA2
Plasmid#185003Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertIAP-del-gRNA2 (Akp3 Mouse)
UseCRISPRAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PGC1a1 sgRNA
Plasmid#165425PurposeExpression of gRNA against human PGC-1a variant 1DepositorInsertgRNA against PGC-1a variant 1 (PPARGC1A Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MTK234_058
Plasmid#123984PurposeEncodes the spCas9 Safetargeting Chr11 gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsg Safetargeting Chr11
ExpressionMammalianAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_038
Plasmid#123917PurposeEncodes the spCas9 pSV40 (site 1) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA-pSV40
ExpressionMammalianAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_043
Plasmid#123913PurposeEncodes the spCas9 pSV40 (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA-pSV40
ExpressionMammalianAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_015
Plasmid#123991PurposeEncodes the spCas9 sgRNA1 hROSA26 (site 4) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInserthROSA26 sg4
ExpressionMammalianAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_047
Plasmid#124055PurposeEncodes the spCas9 mScarlet (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertmScarlet sgRNA 2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_048
Plasmid#124056PurposeEncodes the spCas9 mScarlet (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertmScarlet sgRNA 3
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_049
Plasmid#124057PurposeEncodes the spCas9 mScarlet (site 4) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertmScarlet sgRNA 4
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only