We narrowed to 16,050 results for: Comp;
-
Plasmid#191397PurposesgRNA targeting alpha-satellites on human chromosome 9DepositorInsertsgRNA targeting alpha satellites on human chromosome 9
UseLentiviralExpressionMammalianPromoterU6Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
K-to-R mutant NPRL2(1-380) in pLJM60
Plasmid#184562PurposeCMV-driven expression of an untagged mutant NPRL2 (core subunit of GATOR1) — native sequence for stable expression in mammalian cells. All lysine residues were mutated to arginines.DepositorInsertNPRL2 (NPRL2 Human)
UseLentiviralExpressionMammalianMutationAll lysines were mutated to arginines.PromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NFAM1-Fc(DAPA)-AviTag-6xHis
Plasmid#156501PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNFAM1 (NFAM1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ICOS-Fc(DAPA)-AviTag-6xHis
Plasmid#156498PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertICOS (ICOS Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-LTA-Fc(DAPA)-AviTag-6xHis
Plasmid#156568PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertLTA (LTA Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-KGRQtoSYAA-shRNAres_W
Plasmid#147901PurposeMammalian Expression of HsNot1iso1-KGRQtoSYAA-shRNAresDepositorInsertHsNot1iso1-KGRQtoSYAA-shRNAres (CNOT1 Human)
TagsGFP (G4C mutation)ExpressionMammalianMutationNM_016284.4, K1426S, G1451Y, R1458A, Q1549AAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-IKGRQtoDSYAA-shRNAres_W
Plasmid#147900PurposeMammalian Expression of HsNot1iso1-IKGRQtoDSYAA-shRNAresDepositorInsertHsNot1iso1-IKGRQtoDSYAA-shRNAres (CNOT1 Human)
TagsGFP (G4C mutation)ExpressionMammalianMutationNM_016284.4, I1423D, K1426S, G1451Y, R1458A, and…Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H96
Plasmid#170342PurposeCFP(UST)Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertCFP(UST)Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ERKsubDD-Venus-NES
Plasmid#84630PurposeEncodes C-terminal (substrate) fragment of bimolecular ERK activity reporter (bimEKAR); cytosol targetedDepositorInsertERKsubDD-Venus-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianPromoterCMVAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H90
Plasmid#170340PurposeCFP(UST)_EPACdDEPCD_cp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertCFP(UST)_EPACdDEPCD_cp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-CTLA4-FLN-ELP-His-ybbr
Plasmid#168038PurposeExpresses CTLA-4 with FLN fingerprint domain, ELP linker, 6x-His tag and ybbr tag at the C terminusDepositorInsertCytotoxic T-lymphocyte associated protein 4 (CTLA4 Human)
Tags3x ELP linker, 6x Histag, ddFLN4 (C18S), and ybbr…ExpressionBacterialPromoterT7 promoterAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF086 MBP-CREB 127-135-His
Plasmid#154075PurposeExpresses MBP-CREB_127-135-His (human 9aa CREB peptide as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTAMAHISTEV_PfeAR480A-Q482A
Plasmid#128946Purposeexpresses R480A Q482A mutant of PfeA in E. coliDepositorInsertferric enterobactin receptor
TagsTEV protease cleavable 7xHis and TamAExpressionBacterialMutationSignal peptide sequence has been removed (1-75), …PromoterT7Available SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
RP1B FUS 1-163 QQ4xSS #2
Plasmid#127195PurposeProtein expression for affinity purificationDepositorInsertFUS 1-163 QQ4xSS #2 (FUS Human)
TagshexahistidineExpressionBacterialMutationQQ4xSS #2:Q8S, Q9S, Q60S, Q62S, Q102, Q103, Q139S…Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
MCV-HF LTS220A/S239A
Plasmid#112191PurposeMerkel cell polyomavirus molecular cloneDepositorInsertMCV-HF LTS220A/S239A
MutationT to G mutations at 3313 (nt) and 3370 (nt) of fu…PromoterNone from vector. Insert contains native promoter…Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239-RVR
Plasmid#108863PurposeFnCpf1 Gateway entry plasmid with N623R, K629R and N633R mutationsDepositorInsertFnCpf1-RVR (FnCpf1 with N623R, K629R and N633R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationN623R, K629R and N633R, Cpf1 is rice codon optimi…Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
Plasmid#111388PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Amber
Plasmid#105806PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Amber, cleavable by TEV. Control for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-AmberExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-ORF1-3C-FLAG_ORF2-TEV-mClover3
Plasmid#105803PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C protease; second protein expressed with mClover3, cleavable by TEV protease; tags positions: C-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-FLAG; ORF2: TEV-mClover3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only