171,784 results
-
Plasmid#47048PurposeBglBrick plasmid (=pBbA5c-MTSAe-T1f-MBI(f)-T1002i-Ptrc-trGPPS(co)-LS) coding for MEV pathway enzymes to produce limonene from glucose in E. coliDepositorInsertCodon-optimized sequences for MEV pathway expression in E. coli to produce limonene
UseSynthetic Biology; BglbrickExpressionBacterialMutationR364S mutation in MKPromoterPlacUV5Available SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
GATA3-pCDNA3.1
Plasmid#115271PurposeExpresses human GATA3 in mammalian cellsDepositorAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS2
Plasmid#46954PurposeCloning plasmid for the generation of Knock-In in human cells using rAAV.DepositorTypeEmpty backboneUseAAVAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP-KRAB
Plasmid#46911PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domainDepositorInsertdCas9-BFP-KRAB fusion
UseCRISPR and LentiviralTags2xNLS, BFP, HA, and KRAB domainExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
GFP-TREX1
Plasmid#27219DepositorAvailable SinceJan. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV_ABEmax_P2A_GFP
Plasmid#112101PurposeA:T-to-G:C base editingDepositorInsertABEmax_P2A_GFP
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab5A S34N
Plasmid#28045DepositorAvailable SinceFeb. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
pNoROS-CAT
Plasmid#170152PurposeMammalian expression vector encoding a constitutive nucleolar targeted roGFP and a doxycycline inducible nucleolar targeted catalase. Used to study nucleolar oxidationDepositorInsertsUseGenome integration via sleeping beauty transposon…TagsFLAG tag and Nucleolar Localization Sequence (NoL…ExpressionMammalianPromoterRPBSA and TRE promoterAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-MA4-GFP
Plasmid#114380PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only