We narrowed to 8,759 results for: epor
-
Plasmid#237348PurposeAdenoviral-SREBP-1c cleavage-activation reporter systemDepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only
-
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA(mut 8356-8370)](pAVA3874)
Plasmid#239353PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(WT)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(WT)-mascRNA(mut 8356-8370: ctacgaccacc…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-V600E-IRES-mCherry
Plasmid#221026PurposeFluorescent reporter for expressing a segment of BRAF-V600E CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 promEXOC3
Plasmid#205467PurposeLuciferase reporter of promoter activityDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ GFP-CDK5R1 degron (283-307)-IRES-mCherry
Plasmid#231008PurposeProtein stability reporter construct for CDK5R1 consisting of aa 283-307 for transient overexpression in mammalian cells.DepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-VEGF120-T2A-mCherry
Plasmid#229134PurposeRetrovirus driving overexpression of VEGF120 plus mCherry reporterDepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC-GFP-IRES-mCherry
Plasmid#231232PurposeMYC stability reporter construct (expressing c-myc 2) for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMYC (MYC Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MCRS1-GFP-IRES-mCherry
Plasmid#231231PurposeMCRS1 stability reporter construct for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMCRS1 (MCRS1 Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-GAL4-UAS—sTNFaR-IRES-mCherry-PGK-BFP
Plasmid#223214PurposeLentiviral vector - mCherry reporter and sTNFaR for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220609PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut1-Luc
Plasmid#223664PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 1DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut2-Luc
Plasmid#223665PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 2DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut3-Luc
Plasmid#223666PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at PRE site 3DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut4-Luc
Plasmid#223667PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at PRE site 4DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD M1601E
Plasmid#169828PurposeExpresses C-terminal flag-tagged CAD with mutation at reported dimerization interface of the DHOase domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationM1601E; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1859E
Plasmid#169822PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationS1859E; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-SET-EMD (N-SET-EMD)
Plasmid#217765PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits