We narrowed to 16,161 results for: nans
-
Plasmid#186754PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc1, CAI = 0.925) with y-box binding protein 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::ENO::sNluc1
Plasmid#186755PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc1) with enolase 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::RPL10::sNluc1
Plasmid#186756PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc1) with RPL10 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::RPL15::sNluc1
Plasmid#186757PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc1) with RPL15 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::YB1::sNluc0
Plasmid#186758PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc0, CAI = 1.0) with y-box binding protein 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::YB1::sNluc2
Plasmid#186759PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc2, CAI =0.713) with y-box binding protein 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::YB1::sNluc3
Plasmid#186760PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc3, CAI = 0.663) with y-box binding protein 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::YB1::sNluc4
Plasmid#186761PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc4, CAI = 0.743) with y-box binding protein 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::YB1::sNluc5
Plasmid#186762PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc5, CAI = 0.633) with y-box binding protein 5' and 3' UTRs.DepositorInsertNanoluciferase
PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::RPL15::sNluc2_STOP
Plasmid#186767PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc2) containing a premature stop codon.DepositorInsertNanoluciferase
MutationPremature stop codon at residue 16PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL464
Plasmid#69881Purposea dCirl transcriptional reporter allele that contains an optimized gal4.2::p65 cassette at the start codon of the genomic dCirl ORFDepositorInsertCIRL (Cirl Fly)
UsePhic31-integration vectorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-sumo-EWS_91-199
Plasmid#180465PurposeExpresses the construct His8-sumo-EWS_91-199DepositorInsertEWSR1 (EWSR1 Human)
TagsHis8 and SUMOExpressionBacterialMutationdeleted 1-90, 200-656PromoterT7Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-scrambled
Plasmid#183455PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα constructDepositorInsertscrambled sgRNA
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
RWDD2B_pLENTI-CAG-IRES-GFP
Plasmid#177001PurposeMammalian lentiviral expression vector encoding RWDD2BDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
WDR4_pcDNA6.2/EmGFP-Bsd
Plasmid#176984PurposeMammalian expression vector encoding WDR4 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RWDD2B_pcDNA6.2/EmGFP-Bsd
Plasmid#176956PurposeMammalian expression vector encoding RWDD2B and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCBP3_pcDNA6.2/EmGFP-Bsd
Plasmid#176958PurposeMammalian expression vector encoding PCBP3 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
POFUT2_pcDNA6.2/EmGFP-Bsd
Plasmid#176960PurposeMammalian expression vector encoding POFUT2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-CR-PA
Plasmid#175445PurposeHiFi-compatible destination vector for secreted overexpression of thrombin-cleavable, C-terminal Protein A tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneTagsBiP Secretion Peptide and Thrombin-Protein AExpressionInsectPromoterFused Actin-HSP70Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only