We narrowed to 19,299 results for: MUT
-
Plasmid#146428PurposeInsect Expression of DmGW182-10xmutDepositorInsertDmGW182-10xmut (gw Fly)
ExpressionInsectMutationMultiple mutations compared to NM_166780.1, see a…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD4-mT2A-mutated_rpsL-BSD-F
Plasmid#182338PurposeTemplate plasmid for PCR amplification of initial recombineering cassetteDepositorInsertBSD
UseMouse Targeting; Flp / frtExpressionBacterialAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsC2orf68-EBMmut_K
Plasmid#146761PurposeMammalian Expression of HsC2orf68-EBMmutDepositorInsertHsC2orf68-EBMmut (C2orf68 Human)
ExpressionMammalianAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-mut1_G
Plasmid#146415PurposeMammalian Expression of HsDCP1a-mut1DepositorInsertHsDCP1a-mut1 (DCP1A Human)
ExpressionMammalianAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE2mut_C
Plasmid#146021PurposeInsect Expression of nanos-3UTR-SRE2mtDepositorInsertnanos-3UTR-SRE2mt (nos Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-oskar-SRE1mut_C
Plasmid#146023PurposeInsect Expression of oskar-3UTR-SRE1mutDepositorInsertoskar-3UTR-SRE1mut (osk Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE1,2mut_C
Plasmid#146019PurposeInsect Expression of nanos3UTR-SRE1,2mutDepositorInsertnanos3UTR-SRE1,2mut (nos Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE1mut_C
Plasmid#146020PurposeInsect Expression of nanos-3UTR-SRE1mutDepositorInsertnanos-3UTR-SRE1mut (nos Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmMe31B-mut1_E
Plasmid#146203PurposeInsect Expression of DmMe31B-mut1DepositorInsertDmMe31B-mut1 (me31B Fly)
ExpressionInsectAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TetO::EGFP-hMeikin(8A mut)
Plasmid#174707PurposeDoxycycline inducible expression of human Meikin with 8 alanine mutations that eliminate Plk1 bindingDepositorInsertMeikin
TagsEGFPExpressionMammalianMutationS175A, T176A, T180A, S181A, S196A, T251A, T264A, …Available SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#2
Plasmid#173986PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #2 mutated
UseLuciferaseMutationCoordinator motif mutation #2PromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_7XCoordinatorMutant
Plasmid#173994PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with all 7 Coordinator motifs mutated
UseLuciferaseMutation7X Coordinator motif mutation #1-2-3-4-5-6-7PromoterSV40 promoterAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_min1-2_4XCoordinatorMutant
Plasmid#173962PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with 4 mutated Coordinator motifs
UseLuciferaseMutation4 mutated Coordinator motifsPromoterSV40 promoterAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#1
Plasmid#173985PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #1 mutated
UseLuciferaseMutationCoordinator motif mutation #1PromoterSV40 promoterAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#3
Plasmid#173987PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #3 mutated
UseLuciferaseMutationCoordinator motif mutation #3PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#5
Plasmid#173989PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #5 mutated
UseLuciferaseMutationCoordinator motif mutation #5PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_4XCoordinatorMutant#1-2-3-4
Plasmid#173992PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motifs #1, #2, #3 and #4 mutated
UseLuciferaseMutation4X Coordinator motif mutations #1-2-3-4PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#6
Plasmid#173990PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #6 mutated
UseLuciferaseMutationCoordinator motif mutation #6PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#4
Plasmid#173988PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #4 mutated
UseLuciferaseMutationCoordinator motif mutation #4PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only