-
Plasmid#13766DepositorInsertNdrg4 promoter
UseTagsDsRed2ExpressionMammalianMutationPromoterAvailable sinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1
Plasmid#182380PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsUseTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyTagsExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable sinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_E2419K_Dual_pegRNA
Plasmid#173209PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR E2419K pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crBACH1-array_EF1a-BFP
Plasmid#224787PurposeBACH1 targeting crRNA array for RfxCas13d expressed from multiple hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrBACH1-1, crBACH1-2, crBACH1-3,
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhU6 and hU6-2xTetOAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-CMVp-mito-mTFP1
Plasmid#182378PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsUseTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry
Plasmid#182379PurposeDual expression construct encoding shRNA-resistant mtIF3 and mCherry from separate promotersDepositorInsertsUseTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterHSV TK promoter and SV40 promoterAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197958PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by CmYLCVp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRTagsExpressionPlantMutationPromoterCmYLCVp and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterU6 and synthetic Probasin ARRx2Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#173211PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + MTOR Nick exon-53 sgRNA
UseCRISPR; Prime editing (pe3)TagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only