We narrowed to 16,386 results for: omp
-
Plasmid#170342PurposeCFP(UST)Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertCFP(UST)Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ERKsubDD-Venus-NES
Plasmid#84630PurposeEncodes C-terminal (substrate) fragment of bimolecular ERK activity reporter (bimEKAR); cytosol targetedDepositorInsertERKsubDD-Venus-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianPromoterCMVAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-CTLA4-FLN-ELP-His-ybbr
Plasmid#168038PurposeExpresses CTLA-4 with FLN fingerprint domain, ELP linker, 6x-His tag and ybbr tag at the C terminusDepositorInsertCytotoxic T-lymphocyte associated protein 4 (CTLA4 Human)
Tags3x ELP linker, 6x Histag, ddFLN4 (C18S), and ybbr…ExpressionBacterialPromoterT7 promoterAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF086 MBP-CREB 127-135-His
Plasmid#154075PurposeExpresses MBP-CREB_127-135-His (human 9aa CREB peptide as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTAMAHISTEV_PfeAR480A-Q482A
Plasmid#128946Purposeexpresses R480A Q482A mutant of PfeA in E. coliDepositorInsertferric enterobactin receptor
TagsTEV protease cleavable 7xHis and TamAExpressionBacterialMutationSignal peptide sequence has been removed (1-75), …PromoterT7Available SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
MCV-HF LTS220A/S239A
Plasmid#112191PurposeMerkel cell polyomavirus molecular cloneDepositorInsertMCV-HF LTS220A/S239A
MutationT to G mutations at 3313 (nt) and 3370 (nt) of fu…PromoterNone from vector. Insert contains native promoter…Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239-RVR
Plasmid#108863PurposeFnCpf1 Gateway entry plasmid with N623R, K629R and N633R mutationsDepositorInsertFnCpf1-RVR (FnCpf1 with N623R, K629R and N633R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationN623R, K629R and N633R, Cpf1 is rice codon optimi…Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Amber
Plasmid#105806PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Amber, cleavable by TEV. Control for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-AmberExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-ORF1-3C-FLAG_ORF2-TEV-mClover3
Plasmid#105803PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C protease; second protein expressed with mClover3, cleavable by TEV protease; tags positions: C-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-FLAG; ORF2: TEV-mClover3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET11d-FHis-DND1-Y102A
Plasmid#70082PurposeBacterial expression of FLAG-and 6xHis-tagged human DND1 protein with defective RRM (Y102A). Codons are optimized for bacteria expression.DepositorInsertDnd1 (DND1 Human)
Tags6xHIS and FLAGExpressionBacterialMutationY102A. Codon optimized for bacterial expressionAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET14b-mEKLF
Plasmid#67834PurposeEncodes murine EKLF (nucleotides 71-1215) for in vitro chromatin/transcription reconstitutionDepositorInsertEKLF (Klf1 Mouse)
ExpressionBacterialMutationFull-length mEKLF is aa 20-376; amino acid 19 is …PromoterT7Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-o-R179C-EE
Plasmid#55780PurposeThis is a constitutively activated G protein alpha-o mutant containing an internal EE epitope.DepositorInsertG protein alpha-o with constitutively activating R179C mutation (Gnao1 Rat)
TagsEE epitope was introduced internally with D167E a…ExpressionBacterial and MammalianMutationArginine 179 was replaced with cysteinePromoterCMVAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Flag-Med25-VWA
Plasmid#64772PurposeMammalian expression of Flag-tagged Med25-VWADepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flag‐Tim2
Plasmid#49213Purposeexpresses Flag tagged Tim2DepositorInsertTim2 (Timd2 Mouse)
TagsCD8 signal sequence and FLAGExpressionMammalianMutationno Tim2 signal sequence; R80L and S196D compared …PromoterEF1aAvailable SinceDec. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO GFP DNAJB10
Plasmid#19507DepositorAvailable SinceOct. 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO HIS DNAJB10
Plasmid#19560DepositorAvailable SinceOct. 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK2 (delta MBD)-3xFLAG
Plasmid#239254PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL15 IRES miRFP720-P2A-Blast
Plasmid#248032PurposeConstitutively expresses myc tagged membrane bound IL15, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL15 (IL15 Human)
UseLentiviralTagsMycExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c2X_MBP-LcgcN(C24S)-H6
Plasmid#245527PurposeMaltose binding protein N-terminally fused to His-tagged N-terminal LCGC14 PolB2split intein fragmentDepositorInsertN-terminal Fragment of the LCGC14 Split Intein with C24S Mutation
TagsHexahistidine Tag and Maltose Binding Protein (MB…ExpressionBacterialMutationC24S within the N-terminal fragment of the LCGC14…PromotertacAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only