We narrowed to 41,620 results for: Eras
-
Plasmid#70040PurposeControl plasmid for testing 5'UTR folding elementsDepositorInsertRandom sequence matched for GC-content
UseLuciferaseTagsrenilla luciferaseExpressionMammalianPromoterSV40Available SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HOXB13_#1
Plasmid#70093PurposeExpression of shRNA to human HOXB13, puromycin selectionDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHes1(467)-luc
Plasmid#41723DepositorInsertHes1 Promoter (-467 to +46) (Hes1 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains the murine Hes1 promoter (-467 to +46)PromoterHes1 promoter fragment (-467 to +46)Available SinceMarch 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
mCherry-eDHFR-Cdc42Q61L
Plasmid#107267PurposemCherry-eDHFR-Cdc42Q61L in pIVT vector for in vitro transcription. Note that Cdc42 in this plasmid keeps its CAAX domain.DepositorAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Cry1)-DIO-intron336-dLUC
Plasmid#110056PurposeCry1 transcription luciferase reporterDepositorInsertCry1 promoter and luciferase (Cry1 Mouse)
UseAAV and Cre/LoxExpressionMammalianPromoterCry1Available SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT
Plasmid#98657PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341DepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAC-CTSS
Plasmid#172415PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIG-831_HA-GD2-28z_CAR_TFAP4_Retroviral
Plasmid#207508PurposeThis plasmid can be used to generate retrovirus.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
EXT1- D164A-pLJC2-3XFLAG
Plasmid#215828PurposeEctopic expression of catalytically inactive mutant (EXT1-D164A-FLAG) in mammalian cellsDepositorInsertExostosin glycosyltransferase 1 Mutant (EXT1 Human)
UseLentiviralTags3X FlagExpressionMammalianAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -0
Plasmid#180007PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -2
Plasmid#180012PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pF142 pAcGFP1 SOD1 A4V
Plasmid#26403DepositorAvailable SinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-KATNA1
Plasmid#180650PurposeLentiviral expression vector for KATNA1. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. Internal ID: WISP20-47.DepositorInsertKATNA1 (KATNA1 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationsiRNA resistant to: GGACAGCACUCCCUUGAAAAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PIF3-mEGFP
Plasmid#100283PurposeExpresses PIF3 (1-100 aa) fused with mEGFP in mammalian cellsDepositorInsertPhytochrome interacting factor 3 (PIF3 Mustard Weed)
TagsmEGFPExpressionMammalianMutationN-terminus (1-100 aa) of PIF3 is usedPromoterCAG promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNK5664
Plasmid#219747PurposeDVK_AF CIDAR vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - nnLuz_v4 - tSV40
UseLuciferaseExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX302_HOXB13
Plasmid#70089PurposeExpression of human HOXB13 from CMV promoter, puromycin selection markerDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIZ-EGFP-MYO10-HMM
Plasmid#87257PurposeExpression plasmid to perform NanoSPD assays in insect cells (generates EGFP-tagged bait).DepositorInsertMYO10 (Myo10 Mouse)
ExpressionInsectMutationMyo10 is truncated to contain aa.1-941PromoterOpIE2Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GR-RE_MLPmin_BC1092-luc2
Plasmid#227112PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1092DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1092 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only