We narrowed to 3,367 results for: aaas
-
Plasmid#77271Purpose3rd generation lentiviral gRNA plasmid targeting human NIM1KDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PGM2L1 gRNA (BRDN0001147006)
Plasmid#77147Purpose3rd generation lentiviral gRNA plasmid targeting human PGM2L1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RBKS gRNA (BRDN0001145714)
Plasmid#77040Purpose3rd generation lentiviral gRNA plasmid targeting human RBKSDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TEX14 gRNA (BRDN0001147636)
Plasmid#76834Purpose3rd generation lentiviral gRNA plasmid targeting human TEX14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA2
Plasmid#223520PurposeKnocking out hGSDME in human cellsDepositorAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001145338)
Plasmid#77699Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001146381)
Plasmid#77701Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAR2B gRNA (BRDN0001147315)
Plasmid#76151Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
RIOK1 gRNA (BRDN0001148912)
Plasmid#77659Purpose3rd generation lentiviral gRNA plasmid targeting human RIOK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Promoter Only Target
Plasmid#127669PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYO1300
Plasmid#235741PurposeExpression of VPS34 (REIE to AAAA)_FL - EGFP in mammalian cellsDepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-mSAT
Plasmid#181908PurposeSingle guide RNA with 2XMS2 loops targeting mouse major satellite repeatsDepositorInsertsgRNA-2XMS2-mSAT
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MARK2 gRNA (BRDN0001148032)
Plasmid#77590Purpose3rd generation lentiviral gRNA plasmid targeting human MARK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
BMPR1A gRNA (BRDN0001147772)
Plasmid#77960Purpose3rd generation lentiviral gRNA plasmid targeting human BMPR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only