We narrowed to 11,806 results for: KIN
-
Plasmid#14635DepositorInsertcdk9 D167N (CDK9 Human)
TagsRevExpressionMammalianMutationD167N. Kinase negative mutant.Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (K57A)
Plasmid#197118PurposeExpression of kinase-defective MYC-tagged PSK2 (K57A) / TAOK1 (K57A) in mammalian cellsDepositorInsertTAOK1 (K57A) (TAOK1 Human)
TagsMycExpressionMammalianMutationChanged K 57 to APromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP1-S347A
Plasmid#18993DepositorInsertYes-kinase associated protein S347A mutant (YAP1 Human)
TagsHisExpressionMammalianMutationSerine 347 changed to AlanineAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN) MetNIQ in pBAD
Plasmid#118256PurposeN295A Mutation of MetN in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 295 to Alanine (Ala)PromoterNone and araBAD PromotoerAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Myc-tagged PSK (K57A)
Plasmid#197150PurposeExpression of kinase-deficient MYC-tagged PSK1-alpha (K57A) / TAOK2 (K57A) in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
IL2-AH-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187287PurposeExpress pmCherry-IL2-AH-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH-2A-RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHDC2-2A-CherryRhoAQ63L in pmCherryN1
Plasmid#187292PurposeExpress pmCherry-IL2-AH-deltaC2-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH-deltaC2, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEBG MKK3b (Glu)
Plasmid#50451Purposeactivates p38 in the signaling pathwayDepositorInsertMKK3b (MAP2K3 Human)
TagsGstExpressionMammalianMutationchanged Serine 218 to Glutamic Acid, changed Thre…PromoterSV40Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2-ΔSAMD
Plasmid#226507PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD gene deleted SAM domainDepositorInsertDGKD (DGKD Human)
TagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianMutationdeleted sterile alpha motif domain (deleted amino…PromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHA740D, E758K-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187288PurposeExpress pmCherry-IL2-AH A740D, E758K-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758K, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEBG MKK3b(Glu, delete LXL)
Plasmid#50452Purposeactivates p38 in the signaling pathwayDepositorInsertMKK3b (MAP2K3 Human)
TagsGstExpressionMammalianMutationdeleted L25-I27, changed Serine 218 to Glutamic A…PromoterSV40Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
N229A (EcQ) MetNIQ in pBAD
Plasmid#118257PurposeN229A Mutation in Methionine Binding Protein (MetQ) and Wild Type Methionine ABC Transporter for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 229 to Alanine (Ala) and…PromoterNone and araBAD PromoterAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PSOP1-COMP-blac-flag-his
Plasmid#111003PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein (PSOP1) (PF3D7_0721700 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PSOP7-COMP-blac-flag-his
Plasmid#110996PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein, putative (PSOP7) (PF3D7_1340000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
P28-COMP-blac-flag-his
Plasmid#110990PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertookinete surface protein P28 (PF3D7_1030900 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PSOP24-COMP-blac-flag-his
Plasmid#110983PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein (PSOP24) (PF3D7_0108700 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AtRaf1/Raf2/RbcX2/BSD2/RbcX1
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), N229A (EcQ) MetNIQ in pBAD
Plasmid#118581PurposeN295A Mutation of MetN in Methionine ABC Transporter and N229A Mutation in Methionine Binding Protein (MetQ) for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 229 to Alanine (Ala) and…PromoterNone and araBAD PromotoerAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only