We narrowed to 9,495 results for: BLI;
-
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLV-SFFV-LNPK-WPRE-UbC-Emerald
Plasmid#225953PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-mCherry
Plasmid#225954PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-DNMT3Bcd-2A-mTurquoise
Plasmid#225693PurposeLentiviral expression of rTetR(SE) fused to the catalytic domain of DNMT3B and mTurquoise-NLSDepositorInsertrTetR-DNMT3B catalytic domain (DNMT3B Human, Synthetic)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63(YUM1)
Plasmid#203336Purposeepisomal Cas9 and YUM1-targeting sgRNA expression vector for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
YUM1-targeting sequence
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63
Plasmid#203331Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(T59/T61A)(HA)
Plasmid#195025PurposeGateway vector containing HA-tagged Creb5 with T59/T61A mutationDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61A mutation) (CREB5 Bovine)
UseGateway cloningTags3xHAMutationT59/T61AAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(T59/T61D)(HA)
Plasmid#195026PurposeGateway vector containing HA-tagged Creb5 with T59/T61D mutationDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61D mutation) (CREB5 Bovine)
UseGateway cloningTags3xHAMutationT59/T61DAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Creb5(HA)
Plasmid#195024PurposeHA-tagged Creb5 in pLenti CMV Puro DEST (w118-1) vectorDepositorInsertHA-tagged Creb5 (full length, 508aa) (CREB5 Bovine)
UseLentiviralTags3xHAExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer20-iCreb5(T59/T61A)(HA)
Plasmid#195027PurposeHA-tagged Creb5(T59/T61A) in pInducer20 lentivirus destination vectorDepositorInsertHA-tagged Creb5 (full length, 508aa; with T59/T61A mutation) (CREB5 Bovine)
UseLentiviralTags3xHAExpressionMammalianMutationT59/T61AAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer20-iCreb5(T59/T61D)(HA)
Plasmid#195028PurposeHA-tagged Creb5(T59/T61D) in pInducer20 lentivirus destination vectorDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61D mutation) (CREB5 Bovine)
UseLentiviralTags3xHAExpressionMammalianMutationT59/T61DAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
An HA CAAX pMT2
Plasmid#206116Purposeexpression of Cav2.1 N-terminus (amino acids 1-100) with a C-terminal CAAX (last 10aa of H.Ras) motif and a HA tagDepositorAvailable SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
An CAAX pMT2
Plasmid#206118Purposeexpression of Cav2.1 N-terminus (amino acids 1-100) with C-terminal CAAX (last 10 aa of H.Ras) motifDepositorAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_WT_1kb
Plasmid#194187PurposeIncludes the promoter (1kb) of SMTS (SMANTIS, MANTIS, AK125871)DepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-MIOX
Plasmid#166680PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFP
Plasmid#166674PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A Prk-
Plasmid#162694Purposep1A negative control expressing CbbLS and inactive Prk (Prk K20M S21A)DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialMutationPrk inactive (K20M S21A native protein, this map …PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
FMR1-E17B-P2A-NLuc
Plasmid#157857Purposedonor plasmid for FMR1-NlucDepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only