We narrowed to 41,625 results for: Eras
-
Plasmid#131381PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307Y in Gs MutY.DepositorInsertEcNGsC MutY chimera F307Y
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-pKK223
Plasmid#131382PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308V-pKK223
Plasmid#131393PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.DepositorInsertEcNGsC MutY chimera S308V
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308A-pKK223
Plasmid#131394PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S285C
Plasmid#98665PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S329C
Plasmid#98667PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S329CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V
Plasmid#98658PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D220V
Plasmid#98659PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D220VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D230V
Plasmid#98660PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D230VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L
Plasmid#104465Purposeexpress His tagged P298L hnRNPA2 LCDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R254K
Plasmid#104466Purposeexpress MBP hnRNPA2 LC with 2 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L_S329C
Plasmid#104470Purposeexpress His tagged P298L S329C hnRNPA2 LCDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.27
Plasmid#99362PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.27.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationGlutamic acid 129 to LysinePromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Fascin-Promoter (-210-0)
Plasmid#89826PurposeFascin promoter for luciferase assayDepositorAvailable SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
KC1G3_HUMAN_D0
Plasmid#79685PurposeThis plasmid encodes the kinase domain of KC1G3. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-192-Reporter
Plasmid#71872PurposeMammalian expression vector for the analysis of miR-19α activityDepositorInsertReverse complementary sequence of miR-192
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-193a-5p-Reporter
Plasmid#71873PurposeMammalian expression vector for the analysis of miR-193a-5p activityDepositorInsertReverse complementary sequence of miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-31-192-193a-Reporter
Plasmid#71874PurposeMammalian expression vector for the analysis of miR-31-19α-193a activityDepositorInsertBinding sequence targeted by miR-31, miR192, and miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARF4-no stop
Plasmid#67311PurposehArf4 without stop codon in Gateway Entry vectorDepositorInsertARF4 (ARF4 Human)
UseGateway entry vectorExpressionBacterialMutationV53A, L123P and M134I mutations were unintended P…Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only