We narrowed to 19,665 results for: ire;
-
Plasmid#172763PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-18; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-18
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pISH-Gap43
Plasmid#74336PurposeUse to synthesize riboprobes for in situ hybridization (ISH) probe for Gap43. Not for gene expression.DepositorInsertgrowth associated protein 43 (Gap43 Mouse)
Available SinceMay 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag16-fibcon-iCAM1
Plasmid#205212PurposeThis vector encodes of the synCAM (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAGH42
Plasmid#107249PurposeVipp1-mGFPmut3 (or vipp1-gfp) construct with spectinomycin resistance cassette downstream used to replace the native copy of Vipp1 in Synechocystis (sll0617).DepositorInsertvipp1-gfp
UseSuicide vector for destined for double homologous…TagsmGFPmut3ExpressionBacterialPromoternative promoter of sll0617Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SPIB_P2A_Hygro_Barcode
Plasmid#120483PurposeBarcoded lentiviral vector to express SPIB in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Krox20 promoter pGL3-TATA
Plasmid#21260DepositorAvailable SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CRY2-mCh-superPLDx30
Plasmid#188988PurposeA lentiviral plasmid encoding CRY2-mCh-superPLDx30 (an engineered PLD mutant with 30 times higher activity than the wild-type)DepositorInsertPLD
TagsCRY2 and mCherryExpressionMammalianMutationK109R, P245A, G328S, G381V, G429DAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3
Plasmid#62957PurposeTriplet donor for in vivo RMCE with MiMIC inserts to make Gal4 driver.DepositorInsertT2A-Gal4 in three phases
Available SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCPP5238
Plasmid#128711PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopG1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-10
Plasmid#172743PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-10; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-10
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-KLF7-200-GFPfr1
Plasmid#169799PurposeTHe donor vector for the KLF7 gene locus.DepositorInsertDonor sequence to KLF7 neighbouring region for HR
UseHr donor vector for human actb gene.MutationPartial sequence of GFP is inserted the sequence …Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUWR-Cad-Venus
Plasmid#58328PurposeDestination vector for inserting ubi-Cad-Venus to Drosophila melanogaster genomeDepositorInsertCad-Venus
ExpressionInsectPromoterpoly-ubiquitinAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRcCMV Cep164 (Nigg CW325)
Plasmid#41148DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-42
Plasmid#172758PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-42; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-42
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-UMPS-3xFLAG
Plasmid#87975Purpose3rd generation lentiviral vector for Expression of UMPS in mammalian cellsDepositorAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMK-Cas9-gate
Plasmid#113743PurposeGateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving aminoglycoside phosphotransferase for G418 selection in plants.DepositorInsertCas9
UseCRISPR; Gateway destination vectorPromoterZ. Mays ubiquitin promoter, 35S promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only