We narrowed to 8,846 results for: FIE
-
Plasmid#54468PurposeAn amino-terminal YFP fragment was fused to Gbeta-1. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP (1-158)/beta-1 (GNB1 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-2 in pcDNAI/Amp
Plasmid#54469PurposeAn amino-terminal YFP fragment was fused to Gbeta-2. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-2 (GNB2 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-5 in pcDNAI/Amp
Plasmid#54470PurposeAn amino-terminal YFP fragment was fused to Gbeta-5. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-5 (GNB5 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLCAR-CD19-28z
Plasmid#135991PurposeModular CD28-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralExpressionMammalianPromoterEF1a-shortAvailable SinceJune 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT646 human L1 ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro
Plasmid#213026PurposeExpresses full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLCAR-CD19-CD3z
Plasmid#135993PurposeModular CD3z alone CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralExpressionMammalianPromoterEF1a-shortAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD564 human L1 ORF2p-3xFlag (L1RP, CMV promoter) in pCEP4 Puro
Plasmid#213030PurposeExpresses full length human LINE-1 in human cells (native L1RP sequence), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (L1RP Sequence) with 5' UTR and ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT692 ORF2p-3C-3xF (1-1275, ORFeus-Hs) in pDARMO-PolH2.1
Plasmid#213025PurposeExpresses full length human LINE-1 ORF2p Core (1-1275) with a C-terminal 3xFlag tag for baculovirus production in insect cellsDepositorInsertLINE-1 ORF2p (1-1275)
Tags3C-3xFlag (ORF2p)ExpressionInsectPromoterPolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLCAR-CD19-BBz
Plasmid#135992PurposeModular 41BB-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralExpressionMammalianPromoterEF1a-shortAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT870 human L1 RT- (ORF2p D702Y) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213027PurposeExpresses reverse transcriptase dead (RT- ORF2p D702Y) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, RT- D702Y) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianMutationD702Y (RT- reverse transcriptase catalytic dead)PromoterCMVAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT647 human L1 ORF2p-3xFlag only (ORFeus-Hs, CMV promoter, monocistronic construct) in pCEP4 Puro (derivative of pMT646)
Plasmid#213029PurposeExpresses human LINE-1 ORF2 only in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 ORF2p only (monocistronic, codon optimized ORFeus-Hs sequence) with ORF2-3xFlag
Tags3xFlagExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT1093 human L1 EN- (ORF2p E43S, D145N) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213028PurposeExpresses endonuclease dead (EN- ORF2p E43S, D145N) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, EN- E43S D145N) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianMutationE43S D145N double mutant EN- endonuclease catalyt…PromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBD-BirA_RFWD3:425-774
Plasmid#210884PurposeInsect expression of human RFWD3 fragment S425 to E774. N-terminal biotin acceptor peptide tag and C-terminal 6X His tag.DepositorInsertRFWD3:S425-E774 (RFWD3 Human)
TagsGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBOH-MHL_SEC31A:1-338
Plasmid#210925PurposeInsect expression of human SEC31A fragment M1 to T338. N-terminal 6X His tag with TEV cleavage.DepositorInsertSEC31A:M1-T338 (SEC31A Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBOH-LIC_DDA1:1-102
Plasmid#210902PurposeInsect expression of full-length human DDA1. Untagged.DepositorAvailable SinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits