We narrowed to 13,184 results for: BASE
-
Plasmid#215546PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived hygromycin-NLS-tdTomato selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EPG
Plasmid#215545PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived puromycin-GFP selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-MTS-G3635A-R16-Q2L7-T2176C-UGI-Puro
Plasmid#209648PurposeTo install m.G3635 mutation on mtDNADepositorInsertR16-Q2L7-T2176C
ExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-4300-L1-G1397N
Plasmid#210396PurposeTo correct m.A4300G mutation on mtDNADepositorInsert4300-L1-G1397N
ExpressionMammalianAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-4300-H2-G1397C
Plasmid#210395PurposeTo correct m.A4300G mutation on mtDNADepositorInsert4300-H2-G1397C
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG.Myc-SARS2_3CL(C145A)
Plasmid#200121PurposeExpresses N-terminal Myc-tagged human codon optimyzed SARS-CoV-2 3CL C145A in mammalian cellsDepositorInsertSARS-CoV-2 3CL protease (ORF1ab SARS-CoV-2)
TagsMycExpressionMammalianMutationC145APromoterCAGAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMM4_14L
Plasmid#183063PurposePlasmid expressing a biosensor for acetic acid and pHluorin: BM3R1-Haa1-mTurquoise2 under RET2p, mCherry under HREsYGP1p and sfpHluorin under TDH3p with flanks for genome integration into HO locusDepositorInsertsmCherry
sfpHluorin
BM3R1-HAA1-mTurquoise2
UseSynthetic BiologyTagsmCherry and mTurquoise2ExpressionYeastPromoterRET2, Synthetic promoter, and TDH3Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCL8
Plasmid#176184PurposegRNA cloning cassette with RPR1p-tetO promoter and terminator RPT1t, RPR1p-tetO-GFP-scRNA-RPR1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCL8_28bp
Plasmid#176185Purposeplasmid containing scaffold gRNA for Cas9 followed by a 28bp Csy4 recognition sequence, RPR1p-tetO-GFP-scRNA-28bpCsy4-RPR1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC6-spacer
Plasmid#176178Purposeyeast MoClo level-0 part plasmid type 6 containing non-coding DNA spacer for construction of MoClo plasmids without yeast markerDepositorInsert41 bp non-coding DNA spacer from pYTK048
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD445
Plasmid#168775PurposeExpression of mEos3.2 in MycobacteriumDepositorInsertmEos3.2
ExpressionBacterialAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pColE1-AlphaOmega
Plasmid#165867PurposeTerminal pBlueScript derived high-copy GB Cloning vector with both Alpha and Omega Entry points requires pir gene expression requires EC100D or EC100D116 bacterial strain (DH10B derived)uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG418R-MCS-LexA-VP16-MiniWhite
Plasmid#165894PurposeG418 resistant LexA driver vector with Mini-w+ CDS eye marker. Enhancer grammar GB20 entry point for custom enhancers. Cut-and-paste cloning can be used. Purple-white bacteria colony screening.DepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha1
Plasmid#165858PurposeAlpha1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega1
Plasmid#165860PurposeOmega1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pR6Kg-Alpha2
Plasmid#165863PurposeAlpha level R6K_ origin GB Cloning vector, Conditionally replicative ori, requires pir gene expression requires pir gene expression requires EC100D or EC100D116 bacterial strain (DH10B derived) uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 RL (attR:P35S:TMtb:attL) (GB1506)
Plasmid#160582Purpose35S promoter inverted sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attR and attL)DepositorInsertattR:P35S:TMtb:attL
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only