We narrowed to 15,275 results for: grn
-
Plasmid#69488PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
ExpressionWormPromoterR07E5.16 U6 promoterAvailable sinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorPublicationInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGY037 BSMV-gamma-AmCyan
Plasmid#234818PurposeTo express flourescent protein AmCyan from the gamma genome of Barley Stripe Mosaic Virus Vector (T-DNA)DepositorInsertAmCyan
ExpressionPlantAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-9
Plasmid#193668PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shWRN1
Plasmid#125781Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.dTomato-miR30n
Plasmid#90334PurposemiR30 based shMir knockdownDepositorInsertsdTomato
na
SFFV
miR30n
UseLentiviralAvailable sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U6
Plasmid#173157PurposeSingle guide RNA cassette under U6 promoterDepositorInsertsgRNA cassette under U6 promoter
ExpressionPlantPromoterAtU6-26Available sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB8792
Plasmid#126910PurposeTemplate for PCR amplification of ADE2 gRNA biobrick for targeting Saccharomyces cerevisiae ADE2 geneDepositorInsertADE2 gRNA
UseSynthetic BiologyAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
SGL40C.EFS.RFP657
Plasmid#69147PurposeAdvanced lentiviral Vector for sgRNA (hU6 Promoter) delivery with RFP657 expression (EFS Promoter)DepositorInsertssgRNA
EFS
tagRFP657
Available sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GOLPH3 shRNA
Plasmid#163860PurposeshRNA targeting the coding sequences of GOLPH3DepositorInsertgolgi phosphoprotein 3 (GOLPH3 Human)
ExpressionMammalianAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-TRIM5
Plasmid#132938PurposeAll-in-one huTRIM5 rescue-TRIM5 shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable sinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_1
Plasmid#102970PurposeSuppression of FXNDepositorInsertshFXN_1 (FXN Human)
UseLentiviral and RNAiAvailable sinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_2
Plasmid#102969PurposeSuppression of ABCB7DepositorInsertshABCB7_2 (ABCB7 Human)
UseLentiviral and RNAiAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_1
Plasmid#102968PurposeSuppression of ABCB7DepositorInsertshABCB7_1 (ABCB7 Human)
UseLentiviral and RNAiAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable sinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only