We narrowed to 7,986 results for: 104
-
Plasmid#152061PurposeMammalian expression plasmid for SARS-CoV-2 nsp4DepositorInsertSARS-CoV-2 nsp4 (ORF1ab Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;V5ExpressionMammalianMutationwtPromoterCMVAvailable SinceMay 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-Kan_BR32_00104751
Plasmid#121249PurposeLevel 0 Golden-Gate compatible vectorDepositorInsertBR32_00104751
UseGolden gateMutationMagnaporthe oryzaeAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Kan_BR29_00121041
Plasmid#121233PurposeLevel 0 Golden-Gate compatible vectorDepositorInsertBR29_00121041
UseGolden gateMutationMagnaporthe griseaAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Kan_FR13_00104931
Plasmid#121320PurposeLevel 0 Golden-Gate compatible vectorDepositorInsertFR13_00104931
UseGolden gateMutationMagnaporthe oryzaeAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGALSc104(T499I)
Plasmid#1150DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
Hs.KRAS4b K104A
Plasmid#83152PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), K104A mutationDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Hs.KRAS4b K104Q
Plasmid#83153PurposeGateway ORF Entry clone of human KRAS4B [NM_004985.4 ] with stop codon (for native or N-terminal fusions), K104Q mutationDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pD10AH840AhCas9 (GB1041)
Plasmid#68207PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid partDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removed; human codon optimis…Available SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJC45BS104 L892W
Plasmid#1308DepositorInsertHsp104 L892W (HSP104 Budding Yeast)
Tags10X His tagExpressionBacterialMutationChanged Leu 892 to TrpAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJC45BS104 F130W
Plasmid#1302DepositorInsertHsp104 F130W (HSP104 Budding Yeast)
Tags10X His tagExpressionBacterialMutationChanged Phe 130 to TrpAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJC45BS104 L553W
Plasmid#1306DepositorInsertHsp104 L553W (HSP104 Budding Yeast)
Tags10X His tagExpressionBacterialMutationChanged Leu 553 to TrpAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pTet_KaeCanABC(G104K)
Plasmid#248956PurposeCanABC from K. aerogenes under control of pTet and the native promoter, with CanC mutated (G104K)DepositorInsertKaeCanABC(G104K)
ExpressionBacterialMutationG104KAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Gfa104-hIRβ
Plasmid#236227PurposeExpressing a truncated, constitutively active human insulin receptor (IRβ) in astrocyteDepositorAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK104 [Term_tetA_PartType7]
Plasmid#229341PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Term_tetA_PartType7DepositorInserttetA Terminator
ExpressionBacterialAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPRL1_1-169_C104D
Plasmid#209793PurposeBacterial expression of human PRL-1 C104D mutant without farnesylation motifDepositorInsertPRL-1 (PTP4A1 Human)
Tags6xHisExpressionBacterialMutationaa 1-169 only; C101DPromoterT7Available SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only