We narrowed to 6,530 results for: nls
-
Plasmid#178230PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.NWS.VSVg_mCherry-NLS
Plasmid#178229PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.NWS.S_mCherry-NLS
Plasmid#178228PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.NWS.Ollas_mCherry-NLS
Plasmid#178227PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.V5_mCherry-NLS
Plasmid#178226PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.NWS_mCherry-NLS
Plasmid#178222PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.NWS_mCherry-NLS
Plasmid#178217PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2MPEF-NLS-QUE37C
Plasmid#129326PurposeATP measurement, nucleus, Tol2 transposonDepositorInsertQUEEN-37C
ExpressionMammalianAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
YCe1903 HC_Kan_SV40-NLS_p6
Plasmid#100684Purposepart designed to occupy position 6 of EMMA. Functional category: Signal peptide for subcellular targetingDepositorInsertSV40-NLS
UseSynthetic BiologyAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
DsRed-CPI-17-wt-NLS
Plasmid#100788PurposeMammalian expression of Fluorescent CPI-17 nuclearDepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-CPI-17-T38A-NLS
Plasmid#100780PurposeMammalian expression of CPI-17 neutral mutant nuclearDepositorAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-CPI-17-T38E-NLS
Plasmid#100778PurposeMammalian expression of CPI-17 phospho-mimetic nuclearDepositorAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
mKOet-PCNA-19-SV40NLS-4
Plasmid#57933PurposeLocalization: Nucleus, Excitation: 548, Emission: 561DepositorAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEBG-hBEN-deltaNLS3
Plasmid#22161DepositorInserthBEN (GTF2IRD1 Human)
TagsGST and HisExpressionMammalianMutationDeletion of amino acids 883-889Available SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
4929 TRV2-eTnpBc2xSV40nls-reRNA4PDS
Plasmid#251822PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertEnhanced variant of ISDra2 eTnpBc with guide targeting NbPDS with HDV at 3' end
Tags2xSV40nlsExpressionPlantMutationN4Y/R110K/V192L/L222IAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
4930 TRV2-eTnpBc2xSV40nls-HHreRNA4PDS
Plasmid#251823PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertEnhanced variant of ISDra2 eTnpBc with guide targeting NbPDS flanked by HH-HDV ribozymes
Tags2xSV40nlsExpressionPlantMutationN4Y/R110K/V192L/L222IAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET-Cas9-NLS-6xHis
Plasmid#62933PurposeExpression of Cas9-NLS-6xHis in bacterial cellsDepositorInsertCas9-NLS-6xHis
Tags6xHis tag and NLSExpressionBacterialPromoterT7Available SinceMay 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MBP-2xNLS-tdTomato
Plasmid#104054PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein tdTomato from the MBP promoterDepositorInsert2xNLS-tdTomato
UseAAVTagsNLSPromoterMBPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only