We narrowed to 13,184 results for: BASE

#113953

mammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variant

Erik Procko

Park et al J Biol Chem. 2019 Feb 5. pii: RA118.0061

Feb. 8, 2019

Academic Institutions and Nonprofits only

#111908

Toehold switch sensor to detect IL-8 mRNA with GFP output

James Collins

Takahashi et al Nat Commun. 2018 Aug 21;9(1):3347. doi:

Sept. 4, 2018

Academic Institutions and Nonprofits only

#108183

Binary vectors used for the constitutive expression of tripartite split-sfGFP components (with a 3xHA tag) in plants

Tzu-Yin Liu

Liu et al Plant J. 2018 Feb 16. doi: 10.1111/tpj.1

April 17, 2018

Academic Institutions and Nonprofits only

#104569

Mammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to two DmrA domains

Keith Joung

Tak et al Nat Methods. 2017 Oct 30. doi: 10.1038/n

March 29, 2018

Academic Institutions and Nonprofits only

#104568

Mammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to one DmrA domain

Keith Joung

Tak et al Nat Methods. 2017 Oct 30. doi: 10.1038/n

March 29, 2018

Academic Institutions and Nonprofits only

#105182

Module 2 control - synthetic promoter E2F1 drives ECFP only (no miR1 binding sites)

Timothy Lu

Nissim et al Cell. 2017 Nov 16;171(5):1138-1150.e15.

March 17, 2018

Academic Institutions and Nonprofits only

#102670

Tetracycline inducible expression of GFPmut2 using autoregulation; strong ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assembly

Zach Hensel

Hensel et al PLoS One. 2017 Oct 30;12(10):e0187259. d

Dec. 5, 2017

Academic Institutions and Nonprofits only

#102666

Tetracycline inducible expression of GFPmut2 using bicistronic autoregulation; moderate ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assembly

Zach Hensel

Hensel et al PLoS One. 2017 Oct 30;12(10):e0187259. d

Dec. 1, 2017

Academic Institutions and Nonprofits only

#63854

This pFTV1 vector contains a dopamine binding riboswitch, controlling the translation initaition rate of luciferase gene.

Howard Salis

Espah Borujeni et al Nucleic Acids Res. 2015 Nov 30. pii: gkv

Feb. 19, 2016

Academic Institutions and Nonprofits only

#62715

Inducible; gRNA seq is ATGAGAATCAAGGCGGTCGA

Leonidas Bleris

Moore et al Nucleic Acids Res. 2015 Jan 30;43(2):129

May 29, 2015

Academic Institutions and Nonprofits only