We narrowed to 10,418 results for: UTY
-
Plasmid#213380PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SUCNR1-DuET
Plasmid#213381PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
S1PR4-DuET
Plasmid#213375PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSTR1-DuET
Plasmid#213376PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTGER1-DuET
Plasmid#213370PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(63)-mCherry-FLAG
Plasmid#212809PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(63)-mCherry-FLAG in mammalian cellsDepositorInsertE3(63)
TagsNUbo and mCherry-FLAGExpressionMammalianAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(48)-P2A-3xFLAG-Ubc7
Plasmid#212804PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(48)-P2A-3xFLAG-Ubc7 in mammalian cellsDepositorInsertNUbo-E3(48)-P2A-3xFLAG-Ubc7
ExpressionMammalianAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(48)-mCherry-FLAG
Plasmid#212803PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(48)-mCherry-FLAG in mammalian cellsDepositorInsertE3(48)
TagsNUbo and mCherry-FLAGExpressionMammalianAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
Plasmid#206967PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA7.10, SpG N
UseAAVPromoterCMVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA8e-SpG N aa2-713-InteinN
Plasmid#206968PurposeExpresses TadA8e and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA8e, SpG N
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Myc-E3(1) C885A-CUbo
Plasmid#212800PurposeConstitutive/Doxycycline-inducible expression of Myc-E3(1) C885A-CUbo in mammalian cellsDepositorInsertE3(1)
TagsCUbo and MycExpressionMammalianMutationHOIP(C885A)Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-His8-H2B-CUbo(K63R)
Plasmid#212814PurposeConstitutive or doxycycline-inducible expression of His8-H2B-CUbo(K63R) in mammalian cellsDepositorInsertH2B
Tags8xHis and CUbo(K63R)ExpressionMammalianAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-mCherry-FLAG
Plasmid#212798PurposeConstitutive/Doxycycline-inducible expression of NUbo-mCherry-FLAG in mammalian cellsDepositorInsertNUbo
TagsmCherry-FLAGExpressionMammalianAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(63)-mCherry-VSV
Plasmid#212759PurposeConstitutive expression of NUbo-E3(63)-mCherry-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-mCherry-VSV
Plasmid#212758PurposeConstitutive expression of NUbo-E3(63)-mCherry-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-NLS-VSV
Plasmid#212755PurposeConstitutive expression of NUbo-E3(63)-NLS-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48)-mCherry-VSV
Plasmid#212749PurposeConstitutive expression of NUbo-E3(48)-mCherry-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and mCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only