We narrowed to 27,121 results for: GFP
-
Plasmid#59227PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt4-ex7-9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-TRP1-PGAL1-GFP (F64L, S65T, V163A)
Plasmid#53206PurposeN-terminal chromosomal tagging with stable GFP under control of GAL promoterDepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsGFP (F64L, S65T, V163A) and TRP1PromoterGAL1 promoterAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
10xHis-TEV-ATG5_ATG7_ATG10_ATG12_ATG16L1-TEV-mGFP-StrepII (Human autophagy E3(mGFP)-like enzyme)
Plasmid#169077PurposeInsect codon optimized ATG genes (excluded tags): 10xHis-TEV-ATG5, ATG7, ATG10, ATG12 and ATG16L1-GFP-TEV-StrepIIDepositorInsertsTagsGFP tag, GGlinker, TEV cleavage site. StrepII and…ExpressionBacterial and InsectPromoterPolyhedrin promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRK260
Plasmid#173753PurposeCeLINC plasmidDepositorInsertPrps-0::CRY2(olig)::VHH(GFP)::T2A::CIBN-3xFLAG::MP::unc-54 3' UTR
ExpressionWormPromoterPrps-0Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-FRT-TO-GFP-PALB2 KR
Plasmid#71107Purposemammalian expression of GFP-PALB2 mutant. (first 8 Lysine residues mutated to Arginine)DepositorInsertPALB2 (PALB2 Human)
TagsGFPExpressionMammalianMutationfirst 8 Lysine residues mutated to Arginine (K14-…PromoterCMV/TOAvailable SinceDec. 2, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
acta2_GFP_pA_pDestTolpA2
Plasmid#78684Purposeacta2:GFP transgenesis constructDepositorAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
Man1B1-GFP
Plasmid#163646PurposeExpresses GFP tagged Man1B1 in mammalian cellsDepositorAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAuroraA GFP-AURKA-GFP
Plasmid#157765PurposeExpression of AURKA fused to GFP at both ends in mammalian cells under AurkA promoterDepositorInsertAURKA (AURKA Human)
TagsGFPExpressionMammalianMutationpromoter CMV replaced by AurkA promoterPromoterAURKA minimalAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo19
Plasmid#127612PurposeGFP-tagged Myosin-19DepositorInsertMyo19
TagseGFPExpressionMammalianAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PITPbeta-GFP
Plasmid#58274Purposemammalian expression of GFP-PITP betaDepositorAvailable SinceJuly 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
NLS-LucDM-GFP
Plasmid#127796PurposeThe expressed ORF encodes nucleus location signal with GFP and destabilized mutant Luciferase.DepositorInsertdestabilized mutant (DM) Luciferase
TagsEGFP and FLAG-NLSExpressionMammalianMutationR188Q, R261Q in Firefly Luciferase insertPromoterCMVAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOD2044-intDEG
Plasmid#89366PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pelt-2 (intestine specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPelt-2Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PEX3*-SBP-GFP
Plasmid#120174PurposeExpresses a chimera of the peroxisomal-targeting signal of PEX3, SBP tag and GFP (fluorescent tag)DepositorInsertPeroxisomal biogenesis factor 3 (PEX3 Human)
TagsSBP and eGFPExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRESh-GFPII-S-Dlk1
Plasmid#108931PurposeGFP-tagged vector expressing secreted isoform of Dlk1DepositorInsertDlk1 (Dlk1 Mouse)
TagsGFPIIExpressionMammalianMutationcontains sequences from full length Dlk1A up to t…Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-Ago2
Plasmid#74231PurposeGFP-Ago2 lentiviral vectorDepositorAvailable SinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-ATG9A
Plasmid#198529PurposeExpression of ATG9A-GFP fusion protein in mammalian cellsDepositorInsertATG9A (ATG9A Human)
TagsEGFPExpressionMammalianMutationsilent mutations in codons 4 and 775PromoterCMVAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-YOD1
Plasmid#85664PurposeExpression of human YOD1 with N-terminal GFP tagDepositorAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-nArgBP2
Plasmid#74514PurposeExpress GFP-nArgBP2 fusion protein in mammalian cellsDepositorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV asRILpolyGly GFP (OPDM type 4)
Plasmid#250411PurposeGFP-tagged polyglycine protein expressed from the antisense transcript of RILPL1. This vectors uses 100 GGN optimized codons.DepositorInsertasRILpolyGly
UseAAVTagsGFPExpressionMammalianAvailable SinceMarch 16, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits