We narrowed to 5,485 results for: crispr cas9 grna plasmid
-
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG1
Plasmid#90276Purpose(also pMST621-BB3_gpyrG1_cas9) CRISPR/Cas9 plasmid with gRNA for pyrG1, Cas9DepositorInsertgRNA (pyrg1)
UseA. nigerExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG2
Plasmid#90277Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9DepositorInsertgRNA (pyrg2)
UseA. nigerExpressionBacterialAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-entry-puro
Plasmid#85745PurposeLentiviral vector for generating multiple sgRNAs carrying plasmids by Golden Gate Assembly.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
iCas
Plasmid#84232PurposeExpression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT)DepositorInsertCas9
Tags2A-OFP co-expression and ERT2-ERT2ExpressionMammalianPromoterCMVAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only