We narrowed to 27,414 results for: gfp
-
Plasmid#59228PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt4-ex7-9 and 3' UTR
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable sinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X6
Plasmid#59230PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertkrt5 ex2
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable sinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X3
Plasmid#59227PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt4-ex7-9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable sinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-PI4K2A
Plasmid#221760PurposeStable expression of GFP-PI4K2A in mammalian cellsDepositorAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP-GFP-Sec61β
Plasmid#172442PurposeExpression of ER protein Sec61beta with an N-terminal FKBP-GFP tagDepositorInsertProtein transport protein Sec61 subunit beta
TagsFKBP-GFPExpressionMammalianPromoterCMVAvailable sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFA6a-TRP1-PGAL1-GFP (F64L, S65T, V163A)
Plasmid#53206PurposeN-terminal chromosomal tagging with stable GFP under control of GAL promoterDepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsGFP (F64L, S65T, V163A) and TRP1PromoterGAL1 promoterAvailable sinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-LiMETER-v2
Plasmid#113934PurposeAlso termed as OptoPBer; Express an STIM1-derived optical tether to label and interrogate ER-plasma membrane contact sites (MCS) with light; visualized by GFPDepositorInsertLOV2 and Stim1 polybasic domain (PB)
TagsGFPExpressionMammalianPromoterCMVAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRK260
Plasmid#173753PurposeCeLINC plasmidDepositorInsertPrps-0::CRY2(olig)::VHH(GFP)::T2A::CIBN-3xFLAG::MP::unc-54 3' UTR
ExpressionWormPromoterPrps-0Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-FRT-TO-GFP-PALB2 KR
Plasmid#71107Purposemammalian expression of GFP-PALB2 mutant. (first 8 Lysine residues mutated to Arginine)DepositorInsertPALB2 (PALB2 Human)
TagsGFPExpressionMammalianMutationfirst 8 Lysine residues mutated to Arginine (K14-…PromoterCMV/TOAvailable sinceDec. 2, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Man1B1-GFP
Plasmid#163646PurposeExpresses GFP tagged Man1B1 in mammalian cellsDepositorAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAuroraA GFP-AURKA-GFP
Plasmid#157765PurposeExpression of AURKA fused to GFP at both ends in mammalian cells under AurkA promoterDepositorInsertAURKA (AURKA Human)
TagsGFPExpressionMammalianMutationpromoter CMV replaced by AurkA promoterPromoterAURKA minimalAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
acta2_GFP_pA_pDestTolpA2
Plasmid#78684Purposeacta2:GFP transgenesis constructDepositorAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-Myo19
Plasmid#127612PurposeGFP-tagged Myosin-19DepositorInsertMyo19
TagseGFPExpressionMammalianAvailable sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PITPbeta-GFP
Plasmid#58274Purposemammalian expression of GFP-PITP betaDepositorAvailable sinceJuly 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
NLS-LucDM-GFP
Plasmid#127796PurposeThe expressed ORF encodes nucleus location signal with GFP and destabilized mutant Luciferase.DepositorInsertdestabilized mutant (DM) Luciferase
TagsEGFP and FLAG-NLSExpressionMammalianMutationR188Q, R261Q in Firefly Luciferase insertPromoterCMVAvailable sinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-hNINJ1-GFP
Plasmid#208779PurposeInducibly expresses human NINJ1 tagged with GFPDepositorAvailable sinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PEX3*-SBP-GFP
Plasmid#120174PurposeExpresses a chimera of the peroxisomal-targeting signal of PEX3, SBP tag and GFP (fluorescent tag)DepositorInsertPeroxisomal biogenesis factor 3 (PEX3 Human)
TagsSBP and eGFPExpressionMammalianPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIRESh-GFPII-S-Dlk1
Plasmid#108931PurposeGFP-tagged vector expressing secreted isoform of Dlk1DepositorInsertDlk1 (Dlk1 Mouse)
TagsGFPIIExpressionMammalianMutationcontains sequences from full length Dlk1A up to t…Available sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-Ago2
Plasmid#74231PurposeGFP-Ago2 lentiviral vectorDepositorAvailable sinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only