We narrowed to 27,539 results for: GFP
-
Plasmid#71448PurposeRetroviral expression of K140R-STAT3. Please note that this plasmid contains K140R-STAT3 tagged with FLAG, not GFP.DepositorAvailable sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pMRXIP-GFP-PI4K2A
Plasmid#221760PurposeStable expression of GFP-PI4K2A in mammalian cellsDepositorAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP-GFP-Sec61β
Plasmid#172442PurposeExpression of ER protein Sec61beta with an N-terminal FKBP-GFP tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertProtein transport protein Sec61 subunit beta
TagsFKBP-GFPExpressionMammalianPromoterCMVAvailable sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFA6a-TRP1-PGAL1-GFP (F64L, S65T, V163A)
Plasmid#53206PurposeN-terminal chromosomal tagging with stable GFP under control of GAL promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsGFP (F64L, S65T, V163A) and TRP1PromoterGAL1 promoterAvailable sinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2249 - [1-2] ENTR - Fluor - ce-GFP (1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159847PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-GFP (1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-LiMETER-v2
Plasmid#113934PurposeAlso termed as OptoPBer; Express an STIM1-derived optical tether to label and interrogate ER-plasma membrane contact sites (MCS) with light; visualized by GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLOV2 and Stim1 polybasic domain (PB)
TagsGFPExpressionMammalianPromoterCMVAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDEST-FRT-TO-GFP-PALB2 KR
Plasmid#71107Purposemammalian expression of GFP-PALB2 mutant. (first 8 Lysine residues mutated to Arginine)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPALB2 (PALB2 Human)
TagsGFPExpressionMammalianMutationfirst 8 Lysine residues mutated to Arginine (K14-…PromoterCMV/TOAvailable sinceDec. 2, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Man1B1-GFP
Plasmid#163646PurposeExpresses GFP tagged Man1B1 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmannosidase alpha class 1B member 1 (MAN1B1 Human)
TagsGFPExpressionMammalianAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAuroraA GFP-AURKA-GFP
Plasmid#157765PurposeExpression of AURKA fused to GFP at both ends in mammalian cells under AurkA promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAURKA (AURKA Human)
TagsGFPExpressionMammalianMutationpromoter CMV replaced by AurkA promoterPromoterAURKA minimalAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
acta2_GFP_pA_pDestTolpA2
Plasmid#78684Purposeacta2:GFP transgenesis constructDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertacta2 promoter (acta2 Zebrafish)
UseUnspecifiedPromoteracta2Available sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRK260
Plasmid#173753PurposeCeLINC plasmidDepositorInsertPrps-0::CRY2(olig)::VHH(GFP)::T2A::CIBN-3xFLAG::MP::unc-54 3' UTR
ExpressionWormPromoterPrps-0Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo19
Plasmid#127612PurposeGFP-tagged Myosin-19DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMyo19
TagseGFPExpressionMammalianAvailable sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PITPbeta-GFP
Plasmid#58274Purposemammalian expression of GFP-PITP betaDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPITP beta (PITPNB Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceJuly 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
NLS-LucDM-GFP
Plasmid#127796PurposeThe expressed ORF encodes nucleus location signal with GFP and destabilized mutant Luciferase.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdestabilized mutant (DM) Luciferase
TagsEGFP and FLAG-NLSExpressionMammalianMutationR188Q, R261Q in Firefly Luciferase insertPromoterCMVAvailable sinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
PEX3*-SBP-GFP
Plasmid#120174PurposeExpresses a chimera of the peroxisomal-targeting signal of PEX3, SBP tag and GFP (fluorescent tag)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPeroxisomal biogenesis factor 3 (PEX3 Human)
TagsSBP and eGFPExpressionMammalianPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIRESh-GFPII-S-Dlk1
Plasmid#108931PurposeGFP-tagged vector expressing secreted isoform of Dlk1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDlk1 (Dlk1 Mouse)
TagsGFPIIExpressionMammalianMutationcontains sequences from full length Dlk1A up to t…Available sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-Ago2
Plasmid#74231PurposeGFP-Ago2 lentiviral vectorDepositorAvailable sinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOD2044-intDEG
Plasmid#89366PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pelt-2 (intestine specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPelt-2Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOD2048-csnDEG
Plasmid#89368PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression controlled by Posm-6 (ciliated sensory neuron specific)DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPosm-6Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only