177,718 results
-
Plasmid#108122PurposeRecruitable fluorophoreDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP1A(isoform a, 3-108):mCherry (FKBP1A Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Hygro DEST H2B-mCerulean3
Plasmid#90234PurposeLentiviral vector to express H2B-mCerulean3 under PGK promoter (With Hygromycin Resistance)DepositorInsertH2B
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterPGKAvailable sinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFLAG AXL
Plasmid#105933PurposeMammalian expression of Flag-tagged AXLDepositorAvailable sinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXN22-Dest
Plasmid#105085PurposeYeast mating-based Split Ubiquitin Assay, prey vector for Gateway cloningDepositorTypeEmpty backboneTagsNubG-3xHAExpressionYeastAvailable sinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMS2-P65-HSF1 (HSF1 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterEF1aAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EB3-mScarlet-I
Plasmid#98826PurposeIn vivo visualization of microtuble plus ends (can be used for colocalization studies)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEB3
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DNA-PKcs ABCDE>A
Plasmid#83318Purposehuman DNA-PKcs/ABCDE>alaDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutation6 phosphorylation sites in the ABCDE cluster subs…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-TrxRFP1
Plasmid#98996Purposemammalian expression of a biosensor to monitor thioredoxin redox dynamicsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman thioredoxin 1, GS-rich linker, fused with a redox-sensitive RFP
TagsHis-tagExpressionMammalianPromoterCMVAvailable sinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C0000
Plasmid#91081PurposeModule C, Promoter: none, Gene: none (BaeI site for GT donor cloning), Terminator: noneDepositorTypeEmpty backboneUseUnspecifiedAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
7TFP CDH1 reporter
Plasmid#91704Purposelentiviral luciferase reporter containing CDH1 promoterDepositorInsertCDH1 promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianPromoterCDH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pcDNA3-FLAG-mTET2
Plasmid#89735PurposeExpresses wildtype mouse TET2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTET2 (Tet2 Mouse)
TagsFlagExpressionMammalianAvailable sinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_HSP90B1_WT
Plasmid#82130PurposeGateway Donor vector containing HSP90B1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
bZiPro
Plasmid#86846Purposeexpress NS2B-NS3 protease in E.coliDepositorPublicationInsertsNS3 1-177
NS2B45-96
Tagsa hexahistidine tag and a thrombin cleavage siteExpressionBacterialMutationNS2B cofactor region (residues 45–96) and NS3 pro…PromoterT7Available sinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFA6a-HaloTag-KanMX6
Plasmid#87029PurposeTag S. pombe genes in C terminal with HaloTagDepositorInsertHaloTag
ExpressionBacterial and YeastAvailable sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available sinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pY095
Plasmid#84744PurposeExpresses huLbCpf1-T2A-GFP and crRNA guideDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertshuLbCpf1
GFP
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pP{ELAV-GeneSwitch}
Plasmid#83957PurposeExpresses conditional RU486-dependent GAL4 protein under control of the elav promotorDepositorInsertExpressionInsectPromoterelavAvailable sinceDec. 10, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available sinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSgRNA
UseCRISPRAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by