We narrowed to 27,539 results for: GFP
-
Plasmid#11661Purpose3rd generation lentiviral transfer vector. pPRIME-mating recipient plasmid with Tet-responsive promoter (TREX) controlling GFP expressionDepositorTypeEmpty backboneUseLentiviralTagsGFPExpressionMammalianAvailable sinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pMXspuro-GFP-NBR1-dLIR
Plasmid#74204PurposeRetroviral expression of GFP-NBR1 with aa 727-738 deletionDepositorInsertneighbor of BRCA1 gene 1 (NBR1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationDeleted amino acids 727-738Available sinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-365)-GCN4-GFP-SSPB(micro)
Plasmid#174632PurposeHighly processive KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-365)-GCN4-GFP-SSPB(micro) (Kif1a Synthetic, Mouse)
TagsGFP-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; EGFP: Met1Del; SSPB:…PromoterChicken beta-actinAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Alus-Apobec3G
Plasmid#92348PurposePlasmid for expression of GFP gene with a Apobec3G gene intron derived Alu element containing 3'UTR.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertApobec3G gene intron derived Alu element containing 3'UTR (APOBEC3G Human)
ExpressionMammalianPromoterCMVAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX307 GFP-Kif26b-C
Plasmid#118483Purposelentiviral expression of GFP-Kif26b-C in mammalian cellsDepositorInsertmouse Kif26b-C (Kif26b Mouse)
UseLentiviralTagsGFPExpressionMammalianMutationEncodes GFP fused to amino acid 1735 to 2112 of m…PromoterEF1AAvailable sinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-C1-G3BP1-S149A
Plasmid#135998PurposeS149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertG3BP1 (G3BP1 Human)
TagsEGFPExpressionMammalianMutationS149AAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.0_nucNanobody IRES EGFP
Plasmid#136619PurposePlasmid encoding nuclear localization of the Enhancer nanobody for GFP as a SNAP-Tag-fusion and EGFPDepositorInsertSNAP-Tag-EnhancerNb-NLS (IRES EGFP)
ExpressionMammalianPromoterCMVAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUAST-GFP-RpL10Ab
Plasmid#71729PurposeExpression of Drosophila melanogaster Rpl10Ab-GFP fusionDepositorAvailable sinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B T23N
Plasmid#89450PurposeExpression of GFP-tagged human Rab27B T23N in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman Rab27B T23N (RAB27B Human)
TagseGFPExpressionMammalianMutationT23NPromoterCMVAvailable sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K963_GFP_SNAP
Plasmid#159727PurposeExpresses kinesin-1 (amino acids 1-963) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (full length, 1-963 amino acids), K963 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2B-donor
Plasmid#113823PurposeCRISPR donor plasmid to tag human transcription factor TFAP2B with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTFAP2B homology arms flanking EGFP-IRES-Neo cassette (TFAP2B Human)
UseCRISPRMutationUnknownAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSNAI2-donor
Plasmid#112378PurposeCRISPR donor plasmid to tag human transcription factor SNAI2 with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSNAI2 homology arms flanking EGFP-IRES-Neo cassette (SNAI2 Human)
UseCRISPRAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEY1-donor
Plasmid#112297PurposeCRISPR donor plasmid to tag human transcription factor HEY1 with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHEY1 homology arms flanking EGFP-IRES-Neo cassette (HEY1 Human)
UseCRISPRMutationhg38:8:79765311:G>AAvailable sinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hMeCP2-GFP-R270X
Plasmid#48079PurposeMammalian expression of GFP tagged MeCP2-R270XDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
TagsGFPExpressionMammalianMutationexpresses AT-Hook R270XPromoterCMVAvailable sinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAT-WT-HA-GFP11
Plasmid#177719PurposeER protein alpha-1-antitrypsin (WT) fused to an HA tag and the eleventh β-strand of GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertalpha-1-antitrypsin (SERPINA1 Human)
TagsGFP11 and HAExpressionBacterial and MammalianAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-30nmSAH-DmrA
Plasmid#61680PurposeGFP-labeled SAH scaffold with DmrA attachment siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmEGFP-30nmSAH-DmrA
Available sinceMarch 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPSup_iGFP
Plasmid#149420PurposePlasmid for STARR-seq in tobacco leaves. Enhancer candidates can be inserted just upstream of the minimal promoter. The GFP reporter gene harbors the IV2 intron.DepositorTypeEmpty backboneExpressionPlantAvailable sinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
IST1-GFP
Plasmid#186298PurposeExpresses human IST1 C-terminally fused to GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIST1 homolog (IST1 Human)
TagsGFPExpressionMammalianMutationGFPPromoterCMVAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1aL-nlsGFP-W
Plasmid#126688PurposeConstitutive, ubiquitous, nuclear-localized GFP expression.DepositorInsertnlsGFP
UseLentiviralTags6xHIS and NLSPromoterEF1aLAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by