We narrowed to 13,884 results for: OVA
-
Plasmid#203474PurposeExpresses SV-A 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAG416GAL-1x-HIV-2_PR
Plasmid#201935PurposeExpresses HIV-2 protease from a GAL-1x promoter with a URA3 markerDepositorInsertHIV-2 protease
ExpressionYeastPromoterGAL1Available SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-6xHis-TEV-ORF9c
Plasmid#201023PurposeBacterial expression of codon optimized SARS-CoV-2 ORF9c tagged with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertopen reading frame 9c
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNMT2Δ191-237
Plasmid#198382PurposeBacterial expression plasmid for human DNMT2 deletion mutant; for binding assaysDepositorInsertDNMT2 (TRDMT1 Human)
TagsHis-tagExpressionBacterialMutationdeleted amino acids 191-237PromoterT7Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Yap1-E1-#2
Plasmid#171519Purposedeletion of a genomic locus in Yap1 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
piwi_sgRNA
Plasmid#186653Purposepiwi sgRNA plasmidDepositorInsertPiwi sgRNA Plasmid (piwi Fly)
ExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-742pUC19-tNGFR-P2A-Caspase8
Plasmid#186099PurposeKnockin of truncated NGFR to target geneDepositorInsertCASPASE8
UseCRISPRMutationWT with tNGFR sequenceAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA2
Plasmid#186664PurposeNbr C-tag sgRNA2 plasmidDepositorInsertNbr sgRNA 2 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
Cas9_nonPuro_OSS
Plasmid#186652PurposeCas9 plasmid to express the Cas9 in OSS cellsDepositorInsertOSS Cas9 Expression Plasmid
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pFUW-TetO-NMI
Plasmid#178446Purposedoxycycline-inducible expression of Human NMI in mammalian cellsDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-BATF2
Plasmid#178453Purposedoxycycline-inducible expression of Human BATF2 in mammalian cellsDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP11-Ura
Plasmid#177731PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminus in yeast plasmid withDepositorInsertFlucDM
TagsGFP11, HA, HDEL, and KAR2 Signal SequenceExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGreenII 0229/ProRUBY:GOXL6-Citrine:NOSt
Plasmid#175568PurposepSOUP helper plasmid needed for Agrobacterium-mediated plant transformation - Expression of GOXL genes tagged with Citrine under RUBY promoter for transgene complementation of ruby-6DepositorInsertGOXL6
TagsCitrineExpressionPlantPromoterRUBYAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(K206A/K244A)
Plasmid#177135PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(K206A/K244A) with a TEV protease site located between the GST tag and PolB(K206A/K244A)DepositorInsertPolB
TagsGSTExpressionBacterialPromoterTacAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only