We narrowed to 11,948 results for: 110
-
Plasmid#91091PurposeModule C, Promoter: FMV 34S, Gene: Csy4 (+ BaeI site for GT donor cloning), Terminator: pea rbcsE9DepositorInsertCsy4 (+ BaeI site for GT donor cloning)
UseCRISPRPromoterFMV 34SAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-715MRPprom-MRPcucuc
Plasmid#87199PurposeExpression of ectopic mutated human MRP RNA contstruct from the human RMRP promoter, also contains CMV-puro-t2A-mCherry expression cassette for selection/transfection efficiencyDepositorAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJG363
Plasmid#91183PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A single nickase (nAtCas9_D10A+gNt_R2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG370
Plasmid#91187PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A single nickase no gRNA control (nAtCas9_D10A+gRNActrl+donor)DepositorInsertnAtCas9_D10A+gRNActrl+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAtCas9-D10A_2
Plasmid#91160PurposeCas9 only expression, Cas9 Type: AtCas9_D10A (nickase), Plant Selection: 2x35S:npt IIDepositorInsertAtCas9_D10A (nickase)
UseCRISPRExpressionPlantMutationD10AAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 Poly(A) Sense
Plasmid#46836PurposeExpress cGFP transcript ending in a poly(A) tail [using the SV40 poly(A) signal]DepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 WT MYOC eGLuc2 FLAG
Plasmid#192820PurposeExpresses wild-type myocilin with a C-terminal enhanced Gaussia luciferase and FLAG tagDepositorInsertmyocilin (MYOC Human)
TagsFLAG and enhanced Gaussia luciferase (M43I/M110I)ExpressionMammalianPromoterCMVAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2337_Tier3(SB)-TagBFP2_Puro
Plasmid#169635PurposeTier-3 vector for stable integration of up to three cassettes via sleeping beauty transposase including a TagBFP marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mTagBFP2-p2A-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven mTagBFP2 and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) neo with Smad5 CDS
Plasmid#61800PurposepcDNA3.1(+) with full length mouse Smad5 CDSDepositorInsertSmad5 CDS (Smad5 Mouse)
ExpressionMammalianAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-rap1-K9R
Plasmid#84527PurposeThis plasmid can be used as a donor for subcloning into Gateway destination vectors.DepositorInsertRAP1 (RAP1 Budding Yeast)
UseGateway donor plasmidMutationK(43,61,69,117,240,246,527,582,651)RPromoternoneAvailable SinceJan. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0801
Plasmid#91022PurposeModule A, Promoter: 35S, Gene: Csy4-P2A-AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertCsy4-P2A-AtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoter35SAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/HP + AUG-nLuc-3XFLAG
Plasmid#127322PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from AUG start codon from mRNA with hairpin in 5' UTRDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A1610
Plasmid#91038PurposeModule A, Promoter: ZmUbi, Gene: Csy4-P2A-TaCas9_D10A nickase, Terminator: HSPDepositorInsertCsy4-P2A-TaCas9_D10A nickase
UseCRISPRMutationD10APromoterZmUbiAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
EYFP-Clathrin-19
Plasmid#56584PurposeLocalization: Clathrin Vesicles, Excitation: 513, Emission: 527DepositorAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
px330-MRPsg1
Plasmid#87189Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 1DepositorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTaCas9_6
Plasmid#91169PurposeCas9 only expression, Cas9 Type: TaCas9, Plant Selection: PvUbi2:barDepositorInsertTaCas9
UseCRISPRExpressionPlantAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBL_DK193
Plasmid#156424PurposeInsect cell expression of 3a(Q57H)-sfGFP, needs to be introduced into baculoviral bacmidDepositorInsertSARS-CoV-2 3a protein (Q57H)
TagssfGFP-HisExpressionInsectMutationQ57HPromoterPolyhedrinAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTC365
Plasmid#91214Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, tRNA processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only