We narrowed to 9,978 results for: crispr plasmids
-
Plasmid#238033PurposeEncodes sfGFP-SsrA under constitutive promoter (J23119). Expresses a single guide RNA, which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsssrAPromoterJ23119 (constitutive)Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBE-dGFP-gRNA
Plasmid#226862PurposeHuman gRNA expression vector targeting the Y93H mutation of non-fluorescent EGFP in plasmid pCBE-dGFP; for use with CBEsDepositorInsertSp-gRNA
ExpressionMammalianPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
FB395
Plasmid#203631PurposeTU for the expression of luciferase under a synthetic promoter containing the target sequence for gRNA1 (1xLuc).DepositorInsertR1:G1aG2b.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB396
Plasmid#203632PurposeTU for the expression of luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertR1:G1ab.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB397
Plasmid#203633PurposeTU for the expression of luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertR1:G1abc.3:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.103
Plasmid#184988PurposeExpress Cas9-P2A-Eco1RTDepositorInsertCas9-P2A-Eco1RT
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.102
Plasmid#184987PurposeExpress -Eco1 RT-P2A-Cas9DepositorInsertEco1RT-P2A-Cas9
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP114
Plasmid#120799PurposeE. coli-C. difficile shuttle vector for xylose-inducible expression in C. difficile; Pxyl driving expression of red fluorescent protein (mCherryOpt)DepositorInsertPxyl::mCherryOpt
ExpressionBacterialMutation1.4 kb xylR-Pxyl DNA fragment from C. difficile R…PromoterPxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-tRFP
Plasmid#230938PurposeModified version of the original CROP-seq vector (Addgene #86708), expressing tRFP instead of puroR for FACSDepositorTypeEmpty backboneUseLentiviralTagsTagRFPAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
COM-epegRNA-Dnmt1
Plasmid#211376PurposeDnmt1 targeting epegRNA with COM insertion in gRNA scaffold for v3b PE-eVLP productionDepositorInsertCOM-epegRNA
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MS2-epegRNA-Dnmt1
Plasmid#211372PurposeDnmt1 targeting epegRNA with MS2 insertion in gRNA scaffold for v3 PE-eVLP productionDepositorInsertMS2-epegRNA
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo
Plasmid#108101PurposeLentiviral expression plasmid of cDNA with neomycin resistance gene (empty vector)DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsFLAG tagExpressionMammalianPromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PE2-C
Plasmid#164908PurposeExpresses the C-terminal split-intein fragment of PE2DepositorInsertPE2-C
UseAAVAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only