We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_095
Plasmid#180524PurposedCas9 KTK compatible plasmid. Contains dCas9 and lacZ dropout region with flanking D1.1 overhangs for insertion of gRNA expression assemblyDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE3 (minus strand)
Plasmid#91845PurposeLuciferase reporter for CD69 enhancer (IGI-P0622)DepositorInsertCD69 CaRE3 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationMissing 1 base from 13 base polyT tract beginning…Available SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (plus strand)
Plasmid#91850PurposeLuciferase reporter for IL2RA enhancer (IGI-P0345)DepositorInsertIL2RA CaRE4 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 scramble (plus strand)
Plasmid#91852PurposeLuciferase reporter for IL2RA enhancer (IGI-P0347)DepositorInsertIL2RA CaRE4 scramble (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationSequence scrambled from ch10:6094588-6094934Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (minus strand)
Plasmid#91849PurposeLuciferase reporter for IL2RA enhancer (IGI-P0626)DepositorInsertIL2RA CaRE4 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE1 (plus strand)
Plasmid#91837PurposeLuciferase reporter for IL2RA enhancer (IGI-P0614)DepositorInsertIL2RA CaRE1 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE3 (plus strand)
Plasmid#91844PurposeLuciferase reporter for CD69 enhancer (IGI-P0621)DepositorInsertCD69 CaRE3 (plus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationMissing 1 base from 13 base polyT tract beginning…Available SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (plus strand)
Plasmid#91841PurposeLuciferase reporter for IL2RA enhancer (IGI-P0618)DepositorInsertIL2RA CaRE5 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE3 (minus strand)
Plasmid#91835PurposeLuciferase reporter for IL2RA enhancer (IGI-P0612)DepositorInsertIL2RA CaRE3 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893324 A>G, rs7090530 G>T, rs7090512 A&g…Available SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 SNP (plus strand)
Plasmid#91851PurposeLuciferase reporter for IL2RA enhancer (IGI-P0346)DepositorInsertIL2RA CaRE4 SNP (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs61839660 C>TAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (minus strand)
Plasmid#91836PurposeLuciferase reporter for IL2RA enhancer (IGI-P0613)DepositorInsertIL2RA CaRE5 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE2 (plus strand)
Plasmid#91846PurposeLuciferase reporter for IL2RA enhancer (IGI-P0623)DepositorInsertIL2RA CaRE2 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs6602425 T>G, T>C at chr10:6117603Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE2 (minus strand)
Plasmid#91847PurposeLuciferase reporter for IL2RA enhancer (IGI-P0624)DepositorInsertIL2RA CaRE2 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs6602425 A>C, G>A mutation at chr10:611706…Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only