We narrowed to 91,405 results for: Mal
-
Plasmid#200645PurposeExpressed a eGFP sequence where a chimeric intron with the sequence reference of SNORA40 (NR_002973.1) was insertedDepositorInsertSplit GFP with chimeric intron containing SNORA40
ExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pME234
Plasmid#238104PurposeExpresses ME-ABE ABE7.10-HK with SpCas9 (NGDepositorInsertTadA*7.10(Y123H/N157K)-m_SpnCas9(D10A)
UseCRISPRTagsSV40 bpNLS and SV40 bpNLS-P2A-mCherryExpressionMammalianMutationTadA modifications include Y123H, N157K; NG-nCas9…Available SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMXs-SNAP-p53DD
Plasmid#244168PurposeRetroviral expression of SNAP-p53DDDepositorAvailable SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGuide-RUNX3
Plasmid#246659PurposeGuide RNA for human RUNX3DepositorInsertRUNX3 guide RNA (RUNX3 Human)
UseCRISPRAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD686 A2UCOE-EnAsCas12a-BFP
Plasmid#249159PurposeOverexpression of EnAsCas12a-BFP with blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-EnAsCas12a-TagBFP
UseCRISPR; Cp36 donor dnaExpressionMammalianPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF1-FRT-HaloTag-RPA194-E593Q
Plasmid#247349PurposeExpresses HaloTag-RPA194-E593QDepositorInsertRPA194 (POLR1A) (POLR1A Human)
TagsHaloTagExpressionMammalianMutationRPA194 (POLR1A), mutated with E593QPromoterEF1αAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-MS2-RecT-dCas9-BSD
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CFP-LacI-NUT-KS
Plasmid#238279PurposeFor overexpression of CFP-LacI-NUT-KSDepositorInsertCFP-LacI-NUT-KS
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CFP-LacI-NUT-KS-FtoG
Plasmid#238280PurposeFor overexpression of CFP-LacI-NUT-KS-FtoGDepositorInsertCFP-LacI-NUT-KS-FtoG
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CFP-LacI-NUT
Plasmid#238278PurposeFor overexpression of CFP-LacI-NUTDepositorInsertCFP-LacI-NUT
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA ROSA 4b PhiC31 attP41
Plasmid#242881PurposeMammalian expression of epegRNA for twin prime editing of half the minimal PhiC31 attP site targeting the human ROSA26 siteDepositorInsertepegRNA for PhiC31 attP site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA AAV 4a PhiC31 attP41
Plasmid#242882PurposeMammalian expression of epegRNA for twin prime editing of half the minimal PhiC31 attP site targeting the human AAVS1 siteDepositorInsertepegRNA for PhiC31 attP site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA AAV 3b PhiC31 attP41
Plasmid#242883PurposeMammalian expression of epegRNA for twin prime editing of half the minimal PhiC31 attP site targeting the human AAVS1 siteDepositorInsertepegRNA for PhiC31 attP site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA ROSA 4b Bxb1 attB38
Plasmid#242879PurposeMammalian expression of epegRNA for twin prime editing of half the minimal Bxb1 attB site targeting the human ROSA26 siteDepositorInsertepegRNA for Bxb1 attB site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA ROSA 4a Bxb1 attB38
Plasmid#242878PurposeMammalian expression of epegRNA for twin prime editing of half the minimal Bxb1 attB site targeting the human ROSA26 siteDepositorInsertepegRNA for Bxb1 attB site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA ROSA 4a PhiC31 attP41
Plasmid#242880PurposeMammalian expression of epegRNA for twin prime editing of half the minimal PhiC31 attP site targeting the human ROSA26 siteDepositorInsertepegRNA for PhiC31 attP site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only