We narrowed to 16,007 results for: grna
-
Plasmid#231432PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, FLAG, and OLLASExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only
-
Flowcode_09
Plasmid#231433PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, FLAG, and SExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSDMA67
Plasmid#128356PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNoureothricin (NAT)
UseUnspecifiedPromoterACT1Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
S9_attL1-EGFP-C-term-attL2
Plasmid#128473PurposeEGFP entry cloneDepositorInsertEGFP entry clone
ExpressionBacterialAvailable sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
S6_BstBI_SV40_SwaI
Plasmid#128470PurposeSV40 promoterDepositorInsertSV40 promoter
ExpressionBacterialAvailable sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
S5_EcoRV_Ef1a_AscI
Plasmid#128469PurposeEf1a promoterDepositorInsertEf1a promoter
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S12_EcoRV_PGK_AscI
Plasmid#128476PurposePGK promoterDepositorInsertPGK promoter
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S8_attL1-N-term-EGFP-attL2
Plasmid#128472PurposeEGFP entry clonesDepositorInsertEGFP entry clones
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S7_SwaI_Zeo_PacI
Plasmid#128471PurposeZeo Resistance geneDepositorInsertZeocin Resistance gene
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-mCherry-KASH-WPRE-PA-ITR
Plasmid#259718PurposeExpresses sgRNA under U6 promoter and Cre recominase under hSyn promoter with mCherry-KASH nuclear envelope reporter and contains SapI cut sites for sgRNA cloningDepositorInsertssgRNA
Cre
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromoterU6 and hSynAvailable sinceSept. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-VEGFR2#3 sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196990PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with KDR sgRNADepositorInsertVEGFR2
UseCRISPR and LentiviralAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgGFP4
Plasmid#119876PurposegRNA expression vectorDepositorInsertsgGFP
UseLentiviralExpressionMammalianAvailable sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgFLNB-SK2
Plasmid#119873PurposegRNA expression vectorDepositorAvailable sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgFLNB-SK4
Plasmid#119874PurposegRNA expression vectorDepositorAvailable sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:EDLL:tNos (GB1190)
Plasmid#75404PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the EDLL Transcriptional ActivatorDepositorInsertdCas:EDLL
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_MFE1
Plasmid#84612PurposeIntroduces DSB at MFE1 locus in Y. lipolyticaDepositorPublicationInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available sinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBPGUw-HACK-G4>QF2
Plasmid#80277PurposeGAL4->QF2 HACK construct compatible with GMR attP integrated insertions. Contains 5' and 3' GAL4 homology arms and gRNAs.DepositorInsertQF2
ExpressionInsectAvailable sinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only