We narrowed to 16,389 results for: grna
-
Plasmid#141253PurposeGalactose-inducible expression of Cas9 for addressing one target; Contains guide RNA expression cassette with stuffer and KpnI-Pme1 restriction sites.DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterGAL1 (Cas9), pSNR52 (gRNA)Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PCNA
Plasmid#188686Purposecontrol sgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
pRDB_031
Plasmid#245331PurposeCas12a CRISPRko all-in-one positive control; targets CD47, CD63DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_245
Plasmid#245332PurposeCas12a CRISPRko positive control guide; targets CD46DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_837
Plasmid#245328PurposeCas9 CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_247
Plasmid#245334PurposeCas12a CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA097
Plasmid#245319PurposeCas12a CRISPRko positive control; targets CD46, CD47, CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #1
Plasmid#242700PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJ1-g1g2-K2
Plasmid#218217PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAs, MoClo compatibleDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK7-g7g8-K8
Plasmid#218220PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK3-g3g4-K4
Plasmid#218218PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK5-g5g6-K6
Plasmid#218219PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMETTL16-2-Hygromycin
Plasmid#196200Purposeknockout METTL17DepositorAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only