We narrowed to 15,000 results for: GRN
-
Plasmid#11132DepositorInsertRNAi vector for human protection of telomeres 1(control for 1660) (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
PSUPER-344s(hPot1)
Plasmid#11134DepositorInsertRNAi vector for human protection of telomeres 1(control for 344) (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAH750
Plasmid#91212Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters, structurally optimized gRNA scaffolds)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC363
Plasmid#91211Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtU6 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC303
Plasmid#91210Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC441
Plasmid#91218Purposeprotoplast vector for targeted deletion of MLO gene in barley (PvUbi1 promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC437
Plasmid#91219Purposeprotoplast vector for targeted deletion of MLO gene in barley (CmYLCV promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3_multieditdropout
Plasmid#233458PurposeLevel 2 RECKLEEN plasmid, genome editing of Klebsiella pneumoniaeDepositorInsertLevel 2 RECKLEEN plasmid, Ptac lambda Red operon, Ptet SpG cas9, J23117 acrIIA4
UseCRISPRAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-DAG1
Plasmid#205149PurposeOverexpress DAG1DepositorInsertDystroglycan 1 (DAG1 Human)
UseLentiviralExpressionMammalianMutationCarries common missense variant c.41C>G (p.Ser…PromoterEF-1aAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA1
Plasmid#166913PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA2
Plasmid#166914PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP618_αGCN4-KRAB-CO
Plasmid#211782PurposeSunTag counterpart binding domain, aGCN4, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertaGCN4-mCherry
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect mCherr…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118157PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTER GAMMA-TUBULIN shRNA Human
Plasmid#87955Purposereduced the expression of gamma-tubulin in human cellsDepositorInsertsh gamma-tubulin (TUBG1 Human)
TagsNo-tagExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene.…Available SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-SpCas9-HF1-plus
Plasmid#126775PurposeExpression of increased fidelity SpCas9-HF1-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1.DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only