We narrowed to 15,910 results for: grna
-
Plasmid#199564PurposegRNA expression for FnCas12a in E. coli and clostridiaDepositorInsertSacB
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPthl_fUAvailable sinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-Sth1Cas9
Plasmid#129552PurposeContains codon-optimized Sth1Cas9 and gRNA for streptomycesDepositorInsertSth1Cas9
ExpressionBacterialPromoterrpsL(XC)-BbsIAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAL-pgi_NT
Plasmid#74067PurposepAL374 plasmid carrying the pgi (NT) sgRNA, targeting the non-template strand of pgi, SpecRDepositorPublicationInsertsgRNA pgi (NT)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL-pyk_NT
Plasmid#74072PurposepAL374 plasmid carrying the pyk (NT) sgRNA targeting the non-template strand of pyk, SpecRDepositorPublicationInsertsgRNA pyk (NT)
UseCRISPRExpressionBacterialPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRPromoterU6Available sinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ141D
Plasmid#69293PurposeGateway entry vector; single gRNA under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ132D
Plasmid#69288PurposeGolden Gate entry vector; 1st gRNA under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti_U6-DR30(SapI)_CMV-GFP-WPRE
Plasmid#255032PurposeLentiviral plasmid designed to express an RfxCas13d compatible gRNA from a U6 promoter and GFP from a CMV promoterDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsEGFPAvailable sinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177224PurposeExpresses Ampk1 and Ampk2 targeting gRNAs and Cre-recombinaseDepositorInsertsgPrkaa1/sgPrkaa2
UseLentiviralPromotermU6/hU6Available sinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAK-EL-03
Plasmid#125762PurposeEndlinker for tRNA-gRNA system when using only three guidesDepositorInsertEndlinker
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAL-pgi_T
Plasmid#74066PurposepAL374 plasmid carrying the pgi (T) sgRNA, targeting the template strand of pgi, SpecRDepositorPublicationInsertsgRNA pgi (T)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
U6>Ebf.774(F+E)
Plasmid#59990PurposeU6 promoter driving Ebf.774 (F+E) sgRNADepositorInsertEbf.774 (F+E) sgRNA
UseCRISPRPromoterCiinte.U6Available sinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRDA_886
Plasmid#201162PurposeLentiviral expression of EnAsCas12a CRISPRa gRNA with N' nanobody-ALFA and C' VP64 and NLSDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEFSAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCE38
Plasmid#174432PurposeC. auris LEUpOUT HYG marker CAS9 expression construct. Use with pCE41 gRNA expression construct.DepositorInsertC. auris LEU2 1 of 2, pENO1, Cas9, HYG 1 of 2
UseCRISPRExpressionBacterialAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available sinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLC-EGFP-RIP3
Plasmid#75165PurposeLentiCRISPR-EGFP with sgRNA targeting human RIP3DepositorInsertRIP3 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458-gR2A_ISO
Plasmid#124808PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a> plasmids to convert expression of rat IgG2a hybridomas to isotype of choice.DepositorInserthSPCas9
Tags3XFLAG and GFPExpressionMammalianAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
JME4472
Plasmid#129658PurposeURA3ex_CrisprCas9-yl_RFP: CAS9 vector with URA3ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1m_v1
Plasmid#97083PurposeEncodes an sgRNA that creates a DSB immediately downstream the poly(A) signal of human NEAT1_1 isoformDepositorInsertsgRNA NEAT1m_v1
UseCRISPRPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by