We narrowed to 16,087 results for: grna
-
Plasmid#185061PurposeEf1a driven PE2 with pegRNA for editing C201R mutation (including silent PAM mutation) in KCNQ2. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-mAK1-shRNA-1
Plasmid#185364PurposeFor mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)DepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 GFP
Plasmid#155291PurposeLentivirus for doxycycline inducible expression of human Citron shRNA, GFP marker, based on Addgene 11652DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 GFP
Plasmid#155286PurposeLentiviral expression of human CIT shRNA, GFP expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARID4B.1.0-gDNA
Plasmid#132436PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertARID4B (ARID4B Human)
UseCRISPRAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSRNP3.1.0-gDNA
Plasmid#132472PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCSRNP3 (CSRNP3 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHOXB6.1.0-gDNA
Plasmid#132458PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertHOXB6 (HOXB6 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTF2I.1.0-gDNA
Plasmid#132452PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertGTF2I (GTF2I Human)
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHMG20B.1.0-gDNA
Plasmid#132449PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertHMG20B (HMG20B Human)
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMECOM.1.0-gDNA
Plasmid#132445PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertMECOM (MECOM Human)
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLF10.1.0-gDNA
Plasmid#132433PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertKLF10 (KLF10 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
mmu-miR-30a natural design (NAT)
Plasmid#107791PurposemiR-30a RNAi ExpressionDepositorInsertwhole pre-mmu-miR-30a gene (Mir30a Mouse)
UseRNAiTagsEmGFPExpressionMammalianPromoterCMVAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A TagRFP-T P2A puro
Plasmid#122200PurposeThe plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsspCas9
TagRFP-T
UseLentiviralTagsT2AExpressionMammalianAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLIK sh human Rb 1534 hyg
Plasmid#31500DepositorInsertRB shRNA (RB1 Human)
UseLentiviral and RNAiTagsEGFPExpressionMammalianMutationThe target sequence for shRB 1534 is GAACGATTATCC…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAW005-2
Plasmid#85611PurposeEmpty gRNA delivery vector for Bacillus subtilisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-ON-shCtrl (neo)
Plasmid#192076PurposeLentivirus for Dox-inducible expression of a non-targeting control shRNADepositorInsertnon-targeting randomized sequence
UseLentiviralPromoterH1 / Tet-responsive elementAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-tTRKRAB
Plasmid#12249DepositorInsertTetR-KRAB fusion
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh
Plasmid#159901PurposeMutagenesis of ThDepositorInsertTh (Th Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only