We narrowed to 1,583 results for: CAG promoter
-
Plasmid#85217PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-B
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-HSVTKp-mCherry
Plasmid#182381PurposeDual expression construct encoding shRNA-resistant mtIF3 and mCherry from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterHSV TK promoter and SV40 promoterAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_E2419K_Dual_pegRNA
Plasmid#173209PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR E2419K pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNdrg4-DsRed
Plasmid#13766DepositorInsertNdrg4 promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only